Incidental Mutation 'R8062:Rtel1'
ID619758
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8062 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181340567 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000053120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
Predicted Effect probably damaging
Transcript: ENSMUST00000048608
AA Change: D370G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: D370G

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: D370G

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: D370G

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: D370G

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: D370G

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: D370G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: D370G

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: D370G

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: D370G

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: D186G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: D186G

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184751
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 79,701,144 Y172N possibly damaging Het
Abhd2 T A 7: 79,325,590 M176K possibly damaging Het
Adamts14 A G 10: 61,200,361 probably null Het
Atg2a T C 19: 6,252,579 probably null Het
AW822073 G A 10: 58,223,810 A374V unknown Het
Bach2 G A 4: 32,562,937 G468E probably damaging Het
Bap1 T A 14: 31,257,508 N489K probably benign Het
Btaf1 G A 19: 36,992,465 V1180I probably benign Het
Calm5 A G 13: 3,854,405 H33R probably benign Het
Cnr1 T A 4: 33,944,707 V365E possibly damaging Het
Crym A C 7: 120,201,168 V77G probably damaging Het
Cyp2j7 T A 4: 96,215,350 E316V probably null Het
Dab2 G A 15: 6,427,341 G233D probably damaging Het
Ddx19b A T 8: 111,020,979 S108T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Duxf3 G A 10: 58,231,067 L537F probably damaging Het
Duxf3 A C 10: 58,230,928 M93R probably benign Het
Eif2s2 A G 2: 154,877,804 F182L possibly damaging Het
Erlin1 T A 19: 44,056,159 K156I probably benign Het
Gapvd1 A G 2: 34,678,114 S1413P probably benign Het
Gm1110 G A 9: 26,881,821 A553V probably damaging Het
Gm3250 C A 10: 77,782,400 C48F unknown Het
Gm3604 T C 13: 62,370,341 S68G probably damaging Het
Golga5 T A 12: 102,484,480 M464K probably benign Het
Gpr142 G A 11: 114,806,531 R301Q probably benign Het
Gria4 C T 9: 4,480,273 D392N possibly damaging Het
Grik2 T A 10: 49,240,767 T633S probably damaging Het
Gsap T A 5: 21,194,463 I54N probably damaging Het
Hdlbp A G 1: 93,438,342 Y40H probably benign Het
Hyal5 C A 6: 24,876,197 T23K possibly damaging Het
Itga6 T A 2: 71,841,743 F834L probably benign Het
K230010J24Rik G A 15: 76,046,754 R508H probably benign Het
Klf1 T A 8: 84,903,299 L251Q probably benign Het
Kndc1 A G 7: 139,918,844 D558G probably benign Het
Ktn1 T A 14: 47,724,972 probably null Het
Lcmt2 A G 2: 121,140,272 V110A possibly damaging Het
Lgr4 C T 2: 110,000,937 R304C probably damaging Het
Lnpk T A 2: 74,551,063 I119L possibly damaging Het
Med13 A G 11: 86,319,438 V626A probably benign Het
Mroh9 A T 1: 163,038,975 L700M probably damaging Het
Muc4 T A 16: 32,756,749 W138R Het
Myh2 G T 11: 67,193,383 E1611* probably null Het
Myo9b T G 8: 71,321,813 S323A probably damaging Het
Olfr1086 A C 2: 86,677,066 V89G probably benign Het
Olfr1263 T A 2: 90,015,736 F269I possibly damaging Het
Olfr135 A T 17: 38,209,174 I310F probably benign Het
Olfr888 G T 9: 38,108,917 C72F probably damaging Het
P2ry13 A T 3: 59,210,282 M25K probably benign Het
Pan3 T A 5: 147,527,150 F571Y probably benign Het
Pdcd11 A G 19: 47,130,713 D1831G possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pex1 T G 5: 3,605,656 M161R probably benign Het
Piezo2 T A 18: 63,030,466 D2127V possibly damaging Het
Plod3 A T 5: 136,990,269 H336L possibly damaging Het
Pp2d1 A T 17: 53,515,770 N89K probably benign Het
Ppp4r3a A G 12: 101,041,971 S736P probably damaging Het
Prp2 C A 6: 132,600,688 Q313K unknown Het
Psma5 T G 3: 108,266,479 D90E probably benign Het
Reln G A 5: 21,971,992 T1892I probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 T G 7: 97,677,387 D1039E Het
Scyl2 T A 10: 89,654,160 N447Y probably damaging Het
Sis A T 3: 72,920,988 Y1222* probably null Het
Slc37a3 A T 6: 39,364,596 H35Q probably damaging Het
Sltm A T 9: 70,573,497 K210N unknown Het
Spata3 T C 1: 86,024,426 I134T unknown Het
Speer4d A T 5: 15,620,439 N54I possibly damaging Het
Spert A T 14: 75,592,606 I49N probably benign Het
Syne1 A G 10: 5,185,394 probably null Het
Tars A T 15: 11,388,314 F465Y possibly damaging Het
Tlr4 T G 4: 66,839,850 N293K probably benign Het
Tmprss13 C A 9: 45,328,688 T98K unknown Het
Tnfsf8 G A 4: 63,861,195 probably benign Het
Trim30b T A 7: 104,366,186 probably benign Het
Trpm1 A G 7: 64,201,941 K136E probably benign Het
Ttc6 A G 12: 57,736,978 Y1741C possibly damaging Het
Usp38 T C 8: 80,984,589 D939G probably damaging Het
Vmn1r196 T A 13: 22,293,270 N26K probably damaging Het
Vmn2r50 C A 7: 10,040,313 probably null Het
Wdr3 T A 3: 100,142,494 M773L probably benign Het
Zfp993 T G 4: 146,654,958 probably null Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 splice site probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACAGGGAGAAGCCTCTC -3'
(R):5'- TTCCTGTTCATAAGGAAGGCATG -3'

Sequencing Primer
(F):5'- TAACCTCCTTGAAGTACTCAGC -3'
(R):5'- CCTGTTCATAAGGAAGGCATGATAGC -3'
Posted On2020-01-23