Incidental Mutation 'R8062:Sis'
ID619760
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8062 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 72920988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1222 (Y1222*)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably null
Transcript: ENSMUST00000094190
AA Change: Y1222*
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: Y1222*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167334
AA Change: Y1222*
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: Y1222*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 79,701,144 Y172N possibly damaging Het
Abhd2 T A 7: 79,325,590 M176K possibly damaging Het
Adamts14 A G 10: 61,200,361 probably null Het
Atg2a T C 19: 6,252,579 probably null Het
AW822073 G A 10: 58,223,810 A374V unknown Het
Bach2 G A 4: 32,562,937 G468E probably damaging Het
Bap1 T A 14: 31,257,508 N489K probably benign Het
Btaf1 G A 19: 36,992,465 V1180I probably benign Het
Calm5 A G 13: 3,854,405 H33R probably benign Het
Cnr1 T A 4: 33,944,707 V365E possibly damaging Het
Crym A C 7: 120,201,168 V77G probably damaging Het
Cyp2j7 T A 4: 96,215,350 E316V probably null Het
Dab2 G A 15: 6,427,341 G233D probably damaging Het
Ddx19b A T 8: 111,020,979 S108T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Duxf3 G A 10: 58,231,067 L537F probably damaging Het
Duxf3 A C 10: 58,230,928 M93R probably benign Het
Eif2s2 A G 2: 154,877,804 F182L possibly damaging Het
Erlin1 T A 19: 44,056,159 K156I probably benign Het
Gapvd1 A G 2: 34,678,114 S1413P probably benign Het
Gm1110 G A 9: 26,881,821 A553V probably damaging Het
Gm3250 C A 10: 77,782,400 C48F unknown Het
Gm3604 T C 13: 62,370,341 S68G probably damaging Het
Golga5 T A 12: 102,484,480 M464K probably benign Het
Gpr142 G A 11: 114,806,531 R301Q probably benign Het
Gria4 C T 9: 4,480,273 D392N possibly damaging Het
Grik2 T A 10: 49,240,767 T633S probably damaging Het
Gsap T A 5: 21,194,463 I54N probably damaging Het
Hdlbp A G 1: 93,438,342 Y40H probably benign Het
Hyal5 C A 6: 24,876,197 T23K possibly damaging Het
Itga6 T A 2: 71,841,743 F834L probably benign Het
K230010J24Rik G A 15: 76,046,754 R508H probably benign Het
Klf1 T A 8: 84,903,299 L251Q probably benign Het
Kndc1 A G 7: 139,918,844 D558G probably benign Het
Ktn1 T A 14: 47,724,972 probably null Het
Lcmt2 A G 2: 121,140,272 V110A possibly damaging Het
Lgr4 C T 2: 110,000,937 R304C probably damaging Het
Lnpk T A 2: 74,551,063 I119L possibly damaging Het
Med13 A G 11: 86,319,438 V626A probably benign Het
Mroh9 A T 1: 163,038,975 L700M probably damaging Het
Muc4 T A 16: 32,756,749 W138R Het
Myh2 G T 11: 67,193,383 E1611* probably null Het
Myo9b T G 8: 71,321,813 S323A probably damaging Het
Olfr1086 A C 2: 86,677,066 V89G probably benign Het
Olfr1263 T A 2: 90,015,736 F269I possibly damaging Het
Olfr135 A T 17: 38,209,174 I310F probably benign Het
Olfr888 G T 9: 38,108,917 C72F probably damaging Het
P2ry13 A T 3: 59,210,282 M25K probably benign Het
Pan3 T A 5: 147,527,150 F571Y probably benign Het
Pdcd11 A G 19: 47,130,713 D1831G possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pex1 T G 5: 3,605,656 M161R probably benign Het
Piezo2 T A 18: 63,030,466 D2127V possibly damaging Het
Plod3 A T 5: 136,990,269 H336L possibly damaging Het
Pp2d1 A T 17: 53,515,770 N89K probably benign Het
Ppp4r3a A G 12: 101,041,971 S736P probably damaging Het
Prp2 C A 6: 132,600,688 Q313K unknown Het
Psma5 T G 3: 108,266,479 D90E probably benign Het
Reln G A 5: 21,971,992 T1892I probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 T G 7: 97,677,387 D1039E Het
Rtel1 A G 2: 181,340,567 D370G probably benign Het
Scyl2 T A 10: 89,654,160 N447Y probably damaging Het
Slc37a3 A T 6: 39,364,596 H35Q probably damaging Het
Sltm A T 9: 70,573,497 K210N unknown Het
Spata3 T C 1: 86,024,426 I134T unknown Het
Speer4d A T 5: 15,620,439 N54I possibly damaging Het
Spert A T 14: 75,592,606 I49N probably benign Het
Syne1 A G 10: 5,185,394 probably null Het
Tars A T 15: 11,388,314 F465Y possibly damaging Het
Tlr4 T G 4: 66,839,850 N293K probably benign Het
Tmprss13 C A 9: 45,328,688 T98K unknown Het
Tnfsf8 G A 4: 63,861,195 probably benign Het
Trim30b T A 7: 104,366,186 probably benign Het
Trpm1 A G 7: 64,201,941 K136E probably benign Het
Ttc6 A G 12: 57,736,978 Y1741C possibly damaging Het
Usp38 T C 8: 80,984,589 D939G probably damaging Het
Vmn1r196 T A 13: 22,293,270 N26K probably damaging Het
Vmn2r50 C A 7: 10,040,313 probably null Het
Wdr3 T A 3: 100,142,494 M773L probably benign Het
Zfp993 T G 4: 146,654,958 probably null Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTCCCAAAGATGCTACTG -3'
(R):5'- CTCTAACCTACCGCACAATTGG -3'

Sequencing Primer
(F):5'- GTCCCAAAGATGCTACTGAAATATG -3'
(R):5'- TTACATGTTTTTGGGACCAACC -3'
Posted On2020-01-23