Mutagenetix > Incidental Mutation

Incidental Mutation 'R8062:Trpm1'

619780

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8062 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64201941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 136 (K136E)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: K136E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: K136E

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177102
AA Change: K20E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: K20E

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348
AA Change: K136E

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

silent
Transcript: ENSMUST00000205690

Predicted Effect

probably benign
Transcript: ENSMUST00000205731
AA Change: K20E

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

probably benign
Transcript: ENSMUST00000206107
AA Change: K20E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: K20E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: K136E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206314
AA Change: K136E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000206706
AA Change: K3E

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	A	T	8: 79,701,144	Y172N	possibly damaging	Het
Abhd2	T	A	7: 79,325,590	M176K	possibly damaging	Het
Adamts14	A	G	10: 61,200,361		probably null	Het
Atg2a	T	C	19: 6,252,579		probably null	Het
AW822073	G	A	10: 58,223,810	A374V	unknown	Het
Bach2	G	A	4: 32,562,937	G468E	probably damaging	Het
Bap1	T	A	14: 31,257,508	N489K	probably benign	Het
Btaf1	G	A	19: 36,992,465	V1180I	probably benign	Het
Calm5	A	G	13: 3,854,405	H33R	probably benign	Het
Cnr1	T	A	4: 33,944,707	V365E	possibly damaging	Het
Crym	A	C	7: 120,201,168	V77G	probably damaging	Het
Cyp2j7	T	A	4: 96,215,350	E316V	probably null	Het
Dab2	G	A	15: 6,427,341	G233D	probably damaging	Het
Ddx19b	A	T	8: 111,020,979	S108T	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Duxf3	A	C	10: 58,230,928	M93R	probably benign	Het
Duxf3	G	A	10: 58,231,067	L537F	probably damaging	Het
Eif2s2	A	G	2: 154,877,804	F182L	possibly damaging	Het
Erlin1	T	A	19: 44,056,159	K156I	probably benign	Het
Gapvd1	A	G	2: 34,678,114	S1413P	probably benign	Het
Gm1110	G	A	9: 26,881,821	A553V	probably damaging	Het
Gm3250	C	A	10: 77,782,400	C48F	unknown	Het
Gm3604	T	C	13: 62,370,341	S68G	probably damaging	Het
Golga5	T	A	12: 102,484,480	M464K	probably benign	Het
Gpr142	G	A	11: 114,806,531	R301Q	probably benign	Het
Gria4	C	T	9: 4,480,273	D392N	possibly damaging	Het
Grik2	T	A	10: 49,240,767	T633S	probably damaging	Het
Gsap	T	A	5: 21,194,463	I54N	probably damaging	Het
Hdlbp	A	G	1: 93,438,342	Y40H	probably benign	Het
Hyal5	C	A	6: 24,876,197	T23K	possibly damaging	Het
Itga6	T	A	2: 71,841,743	F834L	probably benign	Het
K230010J24Rik	G	A	15: 76,046,754	R508H	probably benign	Het
Klf1	T	A	8: 84,903,299	L251Q	probably benign	Het
Kndc1	A	G	7: 139,918,844	D558G	probably benign	Het
Ktn1	T	A	14: 47,724,972		probably null	Het
Lcmt2	A	G	2: 121,140,272	V110A	possibly damaging	Het
Lgr4	C	T	2: 110,000,937	R304C	probably damaging	Het
Lnpk	T	A	2: 74,551,063	I119L	possibly damaging	Het
Med13	A	G	11: 86,319,438	V626A	probably benign	Het
Mroh9	A	T	1: 163,038,975	L700M	probably damaging	Het
Muc4	T	A	16: 32,756,749	W138R		Het
Myh2	G	T	11: 67,193,383	E1611*	probably null	Het
Myo9b	T	G	8: 71,321,813	S323A	probably damaging	Het
Olfr1086	A	C	2: 86,677,066	V89G	probably benign	Het
Olfr1263	T	A	2: 90,015,736	F269I	possibly damaging	Het
Olfr135	A	T	17: 38,209,174	I310F	probably benign	Het
Olfr888	G	T	9: 38,108,917	C72F	probably damaging	Het
P2ry13	A	T	3: 59,210,282	M25K	probably benign	Het
Pan3	T	A	5: 147,527,150	F571Y	probably benign	Het
Pdcd11	A	G	19: 47,130,713	D1831G	possibly damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pex1	T	G	5: 3,605,656	M161R	probably benign	Het
Piezo2	T	A	18: 63,030,466	D2127V	possibly damaging	Het
Plod3	A	T	5: 136,990,269	H336L	possibly damaging	Het
Pp2d1	A	T	17: 53,515,770	N89K	probably benign	Het
Ppp4r3a	A	G	12: 101,041,971	S736P	probably damaging	Het
Prp2	C	A	6: 132,600,688	Q313K	unknown	Het
Psma5	T	G	3: 108,266,479	D90E	probably benign	Het
Reln	G	A	5: 21,971,992	T1892I	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rsf1	T	G	7: 97,677,387	D1039E		Het
Rtel1	A	G	2: 181,340,567	D370G	probably benign	Het
Scyl2	T	A	10: 89,654,160	N447Y	probably damaging	Het
Sis	A	T	3: 72,920,988	Y1222*	probably null	Het
Slc37a3	A	T	6: 39,364,596	H35Q	probably damaging	Het
Sltm	A	T	9: 70,573,497	K210N	unknown	Het
Spata3	T	C	1: 86,024,426	I134T	unknown	Het
Speer4d	A	T	5: 15,620,439	N54I	possibly damaging	Het
Spert	A	T	14: 75,592,606	I49N	probably benign	Het
Syne1	A	G	10: 5,185,394		probably null	Het
Tars	A	T	15: 11,388,314	F465Y	possibly damaging	Het
Tlr4	T	G	4: 66,839,850	N293K	probably benign	Het
Tmprss13	C	A	9: 45,328,688	T98K	unknown	Het
Tnfsf8	G	A	4: 63,861,195		probably benign	Het
Trim30b	T	A	7: 104,366,186		probably benign	Het
Ttc6	A	G	12: 57,736,978	Y1741C	possibly damaging	Het
Usp38	T	C	8: 80,984,589	D939G	probably damaging	Het
Vmn1r196	T	A	13: 22,293,270	N26K	probably damaging	Het
Vmn2r50	C	A	7: 10,040,313		probably null	Het
Wdr3	T	A	3: 100,142,494	M773L	probably benign	Het
Zfp993	T	G	4: 146,654,958		probably null	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTAATGCAGAGGGCCCCAAG -3'
(R):5'- CTTCAGTGAGTCCATCAGCG -3'

Sequencing Primer
(F):5'- GATATAGAGAGCCTCCAGACACTG -3'
(R):5'- TGAGTCCATCAGCGCAGACTC -3'

Posted On

2020-01-23