Incidental Mutation 'R8062:Kndc1'
ID 619785
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 067498-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8062 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139498760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 558 (D558G)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: D558G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: D558G

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121839
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 80,427,773 (GRCm39) Y172N possibly damaging Het
Abhd2 T A 7: 78,975,338 (GRCm39) M176K possibly damaging Het
Adamts14 A G 10: 61,036,140 (GRCm39) probably null Het
Atg2a T C 19: 6,302,609 (GRCm39) probably null Het
Bach2 G A 4: 32,562,937 (GRCm39) G468E probably damaging Het
Bap1 T A 14: 30,979,465 (GRCm39) N489K probably benign Het
Btaf1 G A 19: 36,969,865 (GRCm39) V1180I probably benign Het
Calm5 A G 13: 3,904,405 (GRCm39) H33R probably benign Het
Cby2 A T 14: 75,830,046 (GRCm39) I49N probably benign Het
Cnr1 T A 4: 33,944,707 (GRCm39) V365E possibly damaging Het
Crym A C 7: 119,800,391 (GRCm39) V77G probably damaging Het
Cyp2j7 T A 4: 96,103,587 (GRCm39) E316V probably null Het
Dab2 G A 15: 6,456,822 (GRCm39) G233D probably damaging Het
Ddx19b A T 8: 111,747,611 (GRCm39) S108T probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Duxf1 G A 10: 58,059,632 (GRCm39) A374V unknown Het
Duxf3 A C 10: 58,066,750 (GRCm39) M93R probably benign Het
Duxf3 G A 10: 58,066,889 (GRCm39) L537F probably damaging Het
Eif2s2 A G 2: 154,719,724 (GRCm39) F182L possibly damaging Het
Erlin1 T A 19: 44,044,598 (GRCm39) K156I probably benign Het
Gapvd1 A G 2: 34,568,126 (GRCm39) S1413P probably benign Het
Gm1110 G A 9: 26,793,117 (GRCm39) A553V probably damaging Het
Gm3250 C A 10: 77,618,234 (GRCm39) C48F unknown Het
Gm3604 T C 13: 62,518,155 (GRCm39) S68G probably damaging Het
Golga5 T A 12: 102,450,739 (GRCm39) M464K probably benign Het
Gpr142 G A 11: 114,697,357 (GRCm39) R301Q probably benign Het
Gria4 C T 9: 4,480,273 (GRCm39) D392N possibly damaging Het
Grik2 T A 10: 49,116,863 (GRCm39) T633S probably damaging Het
Gsap T A 5: 21,399,461 (GRCm39) I54N probably damaging Het
Hdlbp A G 1: 93,366,064 (GRCm39) Y40H probably benign Het
Hyal5 C A 6: 24,876,196 (GRCm39) T23K possibly damaging Het
Iqank1 G A 15: 75,918,603 (GRCm39) R508H probably benign Het
Itga6 T A 2: 71,672,087 (GRCm39) F834L probably benign Het
Klf1 T A 8: 85,629,928 (GRCm39) L251Q probably benign Het
Ktn1 T A 14: 47,962,429 (GRCm39) probably null Het
Lcmt2 A G 2: 120,970,753 (GRCm39) V110A possibly damaging Het
Lgr4 C T 2: 109,831,282 (GRCm39) R304C probably damaging Het
Lnpk T A 2: 74,381,407 (GRCm39) I119L possibly damaging Het
Med13 A G 11: 86,210,264 (GRCm39) V626A probably benign Het
Mroh9 A T 1: 162,866,544 (GRCm39) L700M probably damaging Het
Muc4 T A 16: 32,577,123 (GRCm39) W138R Het
Myh2 G T 11: 67,084,209 (GRCm39) E1611* probably null Het
Myo9b T G 8: 71,774,457 (GRCm39) S323A probably damaging Het
Or2n1c A T 17: 38,520,065 (GRCm39) I310F probably benign Het
Or4c52 T A 2: 89,846,080 (GRCm39) F269I possibly damaging Het
Or5t7 A C 2: 86,507,410 (GRCm39) V89G probably benign Het
Or8b101 G T 9: 38,020,213 (GRCm39) C72F probably damaging Het
P2ry13 A T 3: 59,117,703 (GRCm39) M25K probably benign Het
Pan3 T A 5: 147,463,960 (GRCm39) F571Y probably benign Het
Pdcd11 A G 19: 47,119,152 (GRCm39) D1831G possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pex1 T G 5: 3,655,656 (GRCm39) M161R probably benign Het
Piezo2 T A 18: 63,163,537 (GRCm39) D2127V possibly damaging Het
Plod3 A T 5: 137,019,123 (GRCm39) H336L possibly damaging Het
Pp2d1 A T 17: 53,822,798 (GRCm39) N89K probably benign Het
Ppp4r3a A G 12: 101,008,230 (GRCm39) S736P probably damaging Het
Prp2 C A 6: 132,577,651 (GRCm39) Q313K unknown Het
Psma5 T G 3: 108,173,795 (GRCm39) D90E probably benign Het
Reln G A 5: 22,176,990 (GRCm39) T1892I probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rsf1 T G 7: 97,326,594 (GRCm39) D1039E Het
Rtel1 A G 2: 180,982,360 (GRCm39) D370G probably benign Het
Scyl2 T A 10: 89,490,022 (GRCm39) N447Y probably damaging Het
Sis A T 3: 72,828,321 (GRCm39) Y1222* probably null Het
Slc37a3 A T 6: 39,341,530 (GRCm39) H35Q probably damaging Het
Sltm A T 9: 70,480,779 (GRCm39) K210N unknown Het
Spata3 T C 1: 85,952,148 (GRCm39) I134T unknown Het
Speer4d A T 5: 15,825,437 (GRCm39) N54I possibly damaging Het
Syne1 A G 10: 5,135,394 (GRCm39) probably null Het
Tars1 A T 15: 11,388,400 (GRCm39) F465Y possibly damaging Het
Tlr4 T G 4: 66,758,087 (GRCm39) N293K probably benign Het
Tmprss13 C A 9: 45,239,986 (GRCm39) T98K unknown Het
Tnfsf8 G A 4: 63,779,432 (GRCm39) probably benign Het
Trim30b T A 7: 104,015,393 (GRCm39) probably benign Het
Trpm1 A G 7: 63,851,689 (GRCm39) K136E probably benign Het
Ttc6 A G 12: 57,783,764 (GRCm39) Y1741C possibly damaging Het
Usp38 T C 8: 81,711,218 (GRCm39) D939G probably damaging Het
Vmn1r196 T A 13: 22,477,440 (GRCm39) N26K probably damaging Het
Vmn2r50 C A 7: 9,774,240 (GRCm39) probably null Het
Wdr3 T A 3: 100,049,810 (GRCm39) M773L probably benign Het
Zfp993 T G 4: 146,739,415 (GRCm39) probably null Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGACCCTGGCCTCCACATATC -3'
(R):5'- AACACTAGCTTCAGCATCGAGG -3'

Sequencing Primer
(F):5'- ACATATCTAGCCAACATGGGG -3'
(R):5'- TTCAGCATCGAGGGCCCTAC -3'
Posted On 2020-01-23