Incidental Mutation 'R8062:Myo9b'
ID 619786
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 067498-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R8062 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 71774457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 323 (S323A)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: S323A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: S323A

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: S323A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: S323A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: S323A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: S323A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212935
AA Change: S323A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 80,427,773 (GRCm39) Y172N possibly damaging Het
Abhd2 T A 7: 78,975,338 (GRCm39) M176K possibly damaging Het
Adamts14 A G 10: 61,036,140 (GRCm39) probably null Het
Atg2a T C 19: 6,302,609 (GRCm39) probably null Het
Bach2 G A 4: 32,562,937 (GRCm39) G468E probably damaging Het
Bap1 T A 14: 30,979,465 (GRCm39) N489K probably benign Het
Btaf1 G A 19: 36,969,865 (GRCm39) V1180I probably benign Het
Calm5 A G 13: 3,904,405 (GRCm39) H33R probably benign Het
Cby2 A T 14: 75,830,046 (GRCm39) I49N probably benign Het
Cnr1 T A 4: 33,944,707 (GRCm39) V365E possibly damaging Het
Crym A C 7: 119,800,391 (GRCm39) V77G probably damaging Het
Cyp2j7 T A 4: 96,103,587 (GRCm39) E316V probably null Het
Dab2 G A 15: 6,456,822 (GRCm39) G233D probably damaging Het
Ddx19b A T 8: 111,747,611 (GRCm39) S108T probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Duxf1 G A 10: 58,059,632 (GRCm39) A374V unknown Het
Duxf3 A C 10: 58,066,750 (GRCm39) M93R probably benign Het
Duxf3 G A 10: 58,066,889 (GRCm39) L537F probably damaging Het
Eif2s2 A G 2: 154,719,724 (GRCm39) F182L possibly damaging Het
Erlin1 T A 19: 44,044,598 (GRCm39) K156I probably benign Het
Gapvd1 A G 2: 34,568,126 (GRCm39) S1413P probably benign Het
Gm1110 G A 9: 26,793,117 (GRCm39) A553V probably damaging Het
Gm3250 C A 10: 77,618,234 (GRCm39) C48F unknown Het
Gm3604 T C 13: 62,518,155 (GRCm39) S68G probably damaging Het
Golga5 T A 12: 102,450,739 (GRCm39) M464K probably benign Het
Gpr142 G A 11: 114,697,357 (GRCm39) R301Q probably benign Het
Gria4 C T 9: 4,480,273 (GRCm39) D392N possibly damaging Het
Grik2 T A 10: 49,116,863 (GRCm39) T633S probably damaging Het
Gsap T A 5: 21,399,461 (GRCm39) I54N probably damaging Het
Hdlbp A G 1: 93,366,064 (GRCm39) Y40H probably benign Het
Hyal5 C A 6: 24,876,196 (GRCm39) T23K possibly damaging Het
Iqank1 G A 15: 75,918,603 (GRCm39) R508H probably benign Het
Itga6 T A 2: 71,672,087 (GRCm39) F834L probably benign Het
Klf1 T A 8: 85,629,928 (GRCm39) L251Q probably benign Het
Kndc1 A G 7: 139,498,760 (GRCm39) D558G probably benign Het
Ktn1 T A 14: 47,962,429 (GRCm39) probably null Het
Lcmt2 A G 2: 120,970,753 (GRCm39) V110A possibly damaging Het
Lgr4 C T 2: 109,831,282 (GRCm39) R304C probably damaging Het
Lnpk T A 2: 74,381,407 (GRCm39) I119L possibly damaging Het
Med13 A G 11: 86,210,264 (GRCm39) V626A probably benign Het
Mroh9 A T 1: 162,866,544 (GRCm39) L700M probably damaging Het
Muc4 T A 16: 32,577,123 (GRCm39) W138R Het
Myh2 G T 11: 67,084,209 (GRCm39) E1611* probably null Het
Or2n1c A T 17: 38,520,065 (GRCm39) I310F probably benign Het
Or4c52 T A 2: 89,846,080 (GRCm39) F269I possibly damaging Het
Or5t7 A C 2: 86,507,410 (GRCm39) V89G probably benign Het
Or8b101 G T 9: 38,020,213 (GRCm39) C72F probably damaging Het
P2ry13 A T 3: 59,117,703 (GRCm39) M25K probably benign Het
Pan3 T A 5: 147,463,960 (GRCm39) F571Y probably benign Het
Pdcd11 A G 19: 47,119,152 (GRCm39) D1831G possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pex1 T G 5: 3,655,656 (GRCm39) M161R probably benign Het
Piezo2 T A 18: 63,163,537 (GRCm39) D2127V possibly damaging Het
Plod3 A T 5: 137,019,123 (GRCm39) H336L possibly damaging Het
Pp2d1 A T 17: 53,822,798 (GRCm39) N89K probably benign Het
Ppp4r3a A G 12: 101,008,230 (GRCm39) S736P probably damaging Het
Prp2 C A 6: 132,577,651 (GRCm39) Q313K unknown Het
Psma5 T G 3: 108,173,795 (GRCm39) D90E probably benign Het
Reln G A 5: 22,176,990 (GRCm39) T1892I probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rsf1 T G 7: 97,326,594 (GRCm39) D1039E Het
Rtel1 A G 2: 180,982,360 (GRCm39) D370G probably benign Het
Scyl2 T A 10: 89,490,022 (GRCm39) N447Y probably damaging Het
Sis A T 3: 72,828,321 (GRCm39) Y1222* probably null Het
Slc37a3 A T 6: 39,341,530 (GRCm39) H35Q probably damaging Het
Sltm A T 9: 70,480,779 (GRCm39) K210N unknown Het
Spata3 T C 1: 85,952,148 (GRCm39) I134T unknown Het
Speer4d A T 5: 15,825,437 (GRCm39) N54I possibly damaging Het
Syne1 A G 10: 5,135,394 (GRCm39) probably null Het
Tars1 A T 15: 11,388,400 (GRCm39) F465Y possibly damaging Het
Tlr4 T G 4: 66,758,087 (GRCm39) N293K probably benign Het
Tmprss13 C A 9: 45,239,986 (GRCm39) T98K unknown Het
Tnfsf8 G A 4: 63,779,432 (GRCm39) probably benign Het
Trim30b T A 7: 104,015,393 (GRCm39) probably benign Het
Trpm1 A G 7: 63,851,689 (GRCm39) K136E probably benign Het
Ttc6 A G 12: 57,783,764 (GRCm39) Y1741C possibly damaging Het
Usp38 T C 8: 81,711,218 (GRCm39) D939G probably damaging Het
Vmn1r196 T A 13: 22,477,440 (GRCm39) N26K probably damaging Het
Vmn2r50 C A 7: 9,774,240 (GRCm39) probably null Het
Wdr3 T A 3: 100,049,810 (GRCm39) M773L probably benign Het
Zfp993 T G 4: 146,739,415 (GRCm39) probably null Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4544:Myo9b UTSW 8 71,780,585 (GRCm39) missense probably damaging 1.00
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8108:Myo9b UTSW 8 71,800,986 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R8924:Myo9b UTSW 8 71,801,675 (GRCm39) missense probably benign
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71,812,246 (GRCm39) missense probably benign 0.07
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9569:Myo9b UTSW 8 71,811,629 (GRCm39) missense probably benign
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTAGACATAAAGAATGGCC -3'
(R):5'- TTGTGCCAAATACCATATCCCAAG -3'

Sequencing Primer
(F):5'- TGAAGCCCTGCCTAGAATTG -3'
(R):5'- AGTTGGCCATTCTTACAGAGGACC -3'
Posted On 2020-01-23