Incidental Mutation 'R8062:Pdcd11'
ID619828
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Nameprogrammed cell death 11
SynonymsALG-4, 1110021I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R8062 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47090766-47131143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47130713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1831 (D1831G)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000072141] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072141
AA Change: D1831G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: D1831G

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 A T 8: 79,701,144 Y172N possibly damaging Het
Abhd2 T A 7: 79,325,590 M176K possibly damaging Het
Adamts14 A G 10: 61,200,361 probably null Het
Atg2a T C 19: 6,252,579 probably null Het
AW822073 G A 10: 58,223,810 A374V unknown Het
Bach2 G A 4: 32,562,937 G468E probably damaging Het
Bap1 T A 14: 31,257,508 N489K probably benign Het
Btaf1 G A 19: 36,992,465 V1180I probably benign Het
Calm5 A G 13: 3,854,405 H33R probably benign Het
Cnr1 T A 4: 33,944,707 V365E possibly damaging Het
Crym A C 7: 120,201,168 V77G probably damaging Het
Cyp2j7 T A 4: 96,215,350 E316V probably null Het
Dab2 G A 15: 6,427,341 G233D probably damaging Het
Ddx19b A T 8: 111,020,979 S108T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Duxf3 G A 10: 58,231,067 L537F probably damaging Het
Duxf3 A C 10: 58,230,928 M93R probably benign Het
Eif2s2 A G 2: 154,877,804 F182L possibly damaging Het
Erlin1 T A 19: 44,056,159 K156I probably benign Het
Gapvd1 A G 2: 34,678,114 S1413P probably benign Het
Gm1110 G A 9: 26,881,821 A553V probably damaging Het
Gm3250 C A 10: 77,782,400 C48F unknown Het
Gm3604 T C 13: 62,370,341 S68G probably damaging Het
Golga5 T A 12: 102,484,480 M464K probably benign Het
Gpr142 G A 11: 114,806,531 R301Q probably benign Het
Gria4 C T 9: 4,480,273 D392N possibly damaging Het
Grik2 T A 10: 49,240,767 T633S probably damaging Het
Gsap T A 5: 21,194,463 I54N probably damaging Het
Hdlbp A G 1: 93,438,342 Y40H probably benign Het
Hyal5 C A 6: 24,876,197 T23K possibly damaging Het
Itga6 T A 2: 71,841,743 F834L probably benign Het
K230010J24Rik G A 15: 76,046,754 R508H probably benign Het
Klf1 T A 8: 84,903,299 L251Q probably benign Het
Kndc1 A G 7: 139,918,844 D558G probably benign Het
Ktn1 T A 14: 47,724,972 probably null Het
Lcmt2 A G 2: 121,140,272 V110A possibly damaging Het
Lgr4 C T 2: 110,000,937 R304C probably damaging Het
Lnpk T A 2: 74,551,063 I119L possibly damaging Het
Med13 A G 11: 86,319,438 V626A probably benign Het
Mroh9 A T 1: 163,038,975 L700M probably damaging Het
Muc4 T A 16: 32,756,749 W138R Het
Myh2 G T 11: 67,193,383 E1611* probably null Het
Myo9b T G 8: 71,321,813 S323A probably damaging Het
Olfr1086 A C 2: 86,677,066 V89G probably benign Het
Olfr1263 T A 2: 90,015,736 F269I possibly damaging Het
Olfr135 A T 17: 38,209,174 I310F probably benign Het
Olfr888 G T 9: 38,108,917 C72F probably damaging Het
P2ry13 A T 3: 59,210,282 M25K probably benign Het
Pan3 T A 5: 147,527,150 F571Y probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pex1 T G 5: 3,605,656 M161R probably benign Het
Piezo2 T A 18: 63,030,466 D2127V possibly damaging Het
Plod3 A T 5: 136,990,269 H336L possibly damaging Het
Pp2d1 A T 17: 53,515,770 N89K probably benign Het
Ppp4r3a A G 12: 101,041,971 S736P probably damaging Het
Prp2 C A 6: 132,600,688 Q313K unknown Het
Psma5 T G 3: 108,266,479 D90E probably benign Het
Reln G A 5: 21,971,992 T1892I probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 T G 7: 97,677,387 D1039E Het
Rtel1 A G 2: 181,340,567 D370G probably benign Het
Scyl2 T A 10: 89,654,160 N447Y probably damaging Het
Sis A T 3: 72,920,988 Y1222* probably null Het
Slc37a3 A T 6: 39,364,596 H35Q probably damaging Het
Sltm A T 9: 70,573,497 K210N unknown Het
Spata3 T C 1: 86,024,426 I134T unknown Het
Speer4d A T 5: 15,620,439 N54I possibly damaging Het
Spert A T 14: 75,592,606 I49N probably benign Het
Syne1 A G 10: 5,185,394 probably null Het
Tars A T 15: 11,388,314 F465Y possibly damaging Het
Tlr4 T G 4: 66,839,850 N293K probably benign Het
Tmprss13 C A 9: 45,328,688 T98K unknown Het
Tnfsf8 G A 4: 63,861,195 probably benign Het
Trim30b T A 7: 104,366,186 probably benign Het
Trpm1 A G 7: 64,201,941 K136E probably benign Het
Ttc6 A G 12: 57,736,978 Y1741C possibly damaging Het
Usp38 T C 8: 80,984,589 D939G probably damaging Het
Vmn1r196 T A 13: 22,293,270 N26K probably damaging Het
Vmn2r50 C A 7: 10,040,313 probably null Het
Wdr3 T A 3: 100,142,494 M773L probably benign Het
Zfp993 T G 4: 146,654,958 probably null Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47117328 missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47098170 missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47103782 missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47107564 missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47114550 intron probably benign
IGL01346:Pdcd11 APN 19 47109614 missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47109629 missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47106304 missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47101165 missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47106421 missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47126942 missense probably benign
IGL02515:Pdcd11 APN 19 47125077 missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47113625 missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47128061 missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47119862 missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47110959 critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47113437 intron probably benign
R0316:Pdcd11 UTSW 19 47113172 missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47125037 intron probably benign
R0577:Pdcd11 UTSW 19 47098832 missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47127291 missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47098187 missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47114556 missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47113437 intron probably benign
R3177:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47127245 intron probably benign
R4495:Pdcd11 UTSW 19 47111006 missense probably benign
R4697:Pdcd11 UTSW 19 47126347 missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47119886 missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47127965 missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47107115 missense probably benign
R5049:Pdcd11 UTSW 19 47107115 missense probably benign
R5103:Pdcd11 UTSW 19 47124454 missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47106454 missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47107115 missense probably benign
R5261:Pdcd11 UTSW 19 47113537 missense probably benign
R5302:Pdcd11 UTSW 19 47107644 missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47102725 missense probably benign
R5769:Pdcd11 UTSW 19 47102637 missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47110991 missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47093808 missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47104759 missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47128332 missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47129263 missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47120283 missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47109752 missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47109678 missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47111081 missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47113142 missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47098226 missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47110979 missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47129234 missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47127997 missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47106369 missense not run
R7759:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47104686 missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47106432 missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47098220 missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47096964 missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47113437 intron probably benign
R8184:Pdcd11 UTSW 19 47113352 nonsense probably null
R8278:Pdcd11 UTSW 19 47106297 missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47104792 missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47119806 missense probably damaging 1.00
RF010:Pdcd11 UTSW 19 47113451 frame shift probably null
RF027:Pdcd11 UTSW 19 47113449 frame shift probably null
RF039:Pdcd11 UTSW 19 47113455 frame shift probably null
RF061:Pdcd11 UTSW 19 47113445 frame shift probably null
X0065:Pdcd11 UTSW 19 47096896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATATCAGAGGGACCTGGTAC -3'
(R):5'- AGTCTGCCTTCTGTGAGCAC -3'

Sequencing Primer
(F):5'- CCTGGTACCTGAGAGTAAGCTG -3'
(R):5'- GCAACTAAAGCAGTCCTGGGAC -3'
Posted On2020-01-23