Incidental Mutation 'R8063:Sctr'
ID619831
Institutional Source Beutler Lab
Gene Symbol Sctr
Ensembl Gene ENSMUSG00000026387
Gene Namesecretin receptor
Synonyms6530402O03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location120006894-120063536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120063275 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 446 (V446A)
Ref Sequence ENSEMBL: ENSMUSP00000139932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056089] [ENSMUST00000072886] [ENSMUST00000189037]
Predicted Effect probably benign
Transcript: ENSMUST00000056089
SMART Domains Protein: ENSMUSP00000050862
Gene: ENSMUSG00000050777

DomainStartEndE-ValueType
Pfam:TMEM37 7 189 4.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072886
AA Change: V463A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072660
Gene: ENSMUSG00000026387
AA Change: V463A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 76 146 5.18e-21 SMART
Pfam:7tm_2 153 398 3.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189037
AA Change: V446A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139932
Gene: ENSMUSG00000026387
AA Change: V446A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 61 131 2.59e-21 SMART
Pfam:7tm_2 138 383 1.9e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and belongs to the glucagon-VIP-secretin receptor family. It binds secretin which is the most potent regulator of pancreatic bicarbonate, electrolyte and volume secretion. Secretin and its receptor are suggested to be involved in pancreatic cancer and autism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show polydipsia, polyuria, decreased urine osmolality, higher serum glucose levels, kidney glomerular and tubular pathology, and impaired renal water reabsorption. Homozygotes for a different null allele show impaired synaptic plasticity and social behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Sctr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Sctr APN 1 120044720 missense probably damaging 1.00
IGL01542:Sctr APN 1 120044769 splice site probably benign
IGL02798:Sctr APN 1 120022180 missense probably damaging 1.00
IGL02850:Sctr APN 1 120044663 missense possibly damaging 0.95
IGL02850:Sctr APN 1 120022179 missense probably damaging 1.00
IGL03256:Sctr APN 1 120031559 splice site probably benign
PIT4677001:Sctr UTSW 1 120061904 missense probably damaging 1.00
R0018:Sctr UTSW 1 120043556 splice site probably benign
R0166:Sctr UTSW 1 120055394 missense probably damaging 0.97
R1678:Sctr UTSW 1 120036439 critical splice donor site probably null
R1728:Sctr UTSW 1 120031656 missense probably benign 0.00
R1728:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1729:Sctr UTSW 1 120031656 missense probably benign 0.00
R1729:Sctr UTSW 1 120063246 missense probably benign 0.16
R1729:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1730:Sctr UTSW 1 120031656 missense probably benign 0.00
R1730:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1739:Sctr UTSW 1 120031656 missense probably benign 0.00
R1739:Sctr UTSW 1 120063246 missense probably benign 0.16
R1739:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1762:Sctr UTSW 1 120031656 missense probably benign 0.00
R1762:Sctr UTSW 1 120063246 missense probably benign 0.16
R1762:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1783:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120063246 missense probably benign 0.16
R1785:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R2116:Sctr UTSW 1 120031582 missense probably damaging 1.00
R5522:Sctr UTSW 1 120036416 missense probably benign 0.10
R5776:Sctr UTSW 1 120056407 missense probably damaging 1.00
R5781:Sctr UTSW 1 120031620 missense probably damaging 0.99
R6333:Sctr UTSW 1 120056452 missense probably damaging 1.00
R7084:Sctr UTSW 1 120063271 missense possibly damaging 0.77
R7263:Sctr UTSW 1 120022225 missense probably benign
R7265:Sctr UTSW 1 120022225 missense probably benign
R7266:Sctr UTSW 1 120022225 missense probably benign
R7304:Sctr UTSW 1 120022240 missense probably damaging 1.00
R7343:Sctr UTSW 1 120022225 missense probably benign
X0067:Sctr UTSW 1 120007299 missense probably benign
Z1088:Sctr UTSW 1 120036406 frame shift probably null
Z1176:Sctr UTSW 1 120022249 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCAGTGAGTTGGGTTCC -3'
(R):5'- CAAATCCCAGGCCTGTTTCC -3'

Sequencing Primer
(F):5'- CAATTGCTGCAGCTGATGGC -3'
(R):5'- CTGCTCCAGGATGACCTAGTC -3'
Posted On2020-01-23