Incidental Mutation 'R8063:Megf9'
ID619837
Institutional Source Beutler Lab
Gene Symbol Megf9
Ensembl Gene ENSMUSG00000039270
Gene Namemultiple EGF-like-domains 9
SynonymsEgfl5, 4933405H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location70427065-70534995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70488258 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 224 (C224R)
Ref Sequence ENSEMBL: ENSMUSP00000102982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037881] [ENSMUST00000107359]
Predicted Effect probably damaging
Transcript: ENSMUST00000037881
AA Change: C224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040801
Gene: ENSMUSG00000039270
AA Change: C224R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
EGF_Lam 202 252 3.97e-9 SMART
TNFR 236 271 3.38e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107359
AA Change: C224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102982
Gene: ENSMUSG00000039270
AA Change: C224R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
EGF_Lam 202 249 2.8e-9 SMART
TNFR 236 272 1.26e-1 SMART
EGF_Lam 252 296 2.13e-9 SMART
EGF_Lam 299 344 1.42e-10 SMART
EGF_Lam 347 395 6.3e-3 SMART
EGF_Lam 398 447 3.05e-10 SMART
transmembrane domain 513 535 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Megf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Megf9 APN 4 70448791 missense probably null 1.00
IGL01697:Megf9 APN 4 70433472 missense possibly damaging 0.65
IGL03291:Megf9 APN 4 70488150 missense probably benign 0.05
R0020:Megf9 UTSW 4 70488149 missense probably benign 0.45
R0325:Megf9 UTSW 4 70455941 missense probably damaging 1.00
R0542:Megf9 UTSW 4 70435348 missense probably benign
R1144:Megf9 UTSW 4 70534624 missense probably benign 0.10
R1843:Megf9 UTSW 4 70534785 missense probably damaging 1.00
R2085:Megf9 UTSW 4 70448767 missense probably damaging 1.00
R2168:Megf9 UTSW 4 70433442 missense probably damaging 0.99
R4656:Megf9 UTSW 4 70448767 missense probably damaging 1.00
R4718:Megf9 UTSW 4 70448778 missense possibly damaging 0.49
R4832:Megf9 UTSW 4 70534428 missense probably damaging 0.99
R6573:Megf9 UTSW 4 70488172 nonsense probably null
R6978:Megf9 UTSW 4 70433529 missense probably benign 0.12
R7243:Megf9 UTSW 4 70435471 missense probably benign 0.03
R7481:Megf9 UTSW 4 70433442 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCTCCAAGTTTCCCAAC -3'
(R):5'- CACACCCACTACATTGGCTTAG -3'

Sequencing Primer
(F):5'- CCAAGTTTCCCAACACAGTTTC -3'
(R):5'- CACTACATTGGCTTAGAATACGC -3'
Posted On2020-01-23