Incidental Mutation 'R8063:Armc10'
ID619841
Institutional Source Beutler Lab
Gene Symbol Armc10
Ensembl Gene ENSMUSG00000038525
Gene Namearmadillo repeat containing 10
Synonyms2810037C14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21645813-21662694 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 21648770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000072896] [ENSMUST00000095495] [ENSMUST00000115234] [ENSMUST00000148873]
Predicted Effect probably benign
Transcript: ENSMUST00000051358
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072896
SMART Domains Protein: ENSMUSP00000072669
Gene: ENSMUSG00000038525

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 48 300 2e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095495
SMART Domains Protein: ENSMUSP00000093149
Gene: ENSMUSG00000038525

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 48 234 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115234
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148873
SMART Domains Protein: ENSMUSP00000120269
Gene: ENSMUSG00000038525

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 38 286 4.7e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Armc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Armc10 APN 5 21661581 missense probably damaging 1.00
IGL01647:Armc10 APN 5 21646093 utr 5 prime probably benign
IGL02296:Armc10 APN 5 21660633 missense probably benign 0.00
R0220:Armc10 UTSW 5 21661584 missense probably benign 0.05
R0308:Armc10 UTSW 5 21647297 intron probably benign
R1757:Armc10 UTSW 5 21653457 missense probably damaging 1.00
R4332:Armc10 UTSW 5 21661581 missense probably damaging 1.00
R4486:Armc10 UTSW 5 21653434 missense probably damaging 1.00
R4656:Armc10 UTSW 5 21661550 missense probably benign 0.11
R4741:Armc10 UTSW 5 21651836 missense probably damaging 1.00
R4906:Armc10 UTSW 5 21661524 missense probably damaging 1.00
R5273:Armc10 UTSW 5 21653428 missense possibly damaging 0.89
R5988:Armc10 UTSW 5 21660583 missense probably damaging 1.00
R7088:Armc10 UTSW 5 21653392 missense probably damaging 0.96
R7212:Armc10 UTSW 5 21660583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGCTTCCTTCTTATGCAG -3'
(R):5'- AGGCACTGCTCAACTTTAAGG -3'

Sequencing Primer
(F):5'- TCTTATGCAGAAGACCTAACCGATGG -3'
(R):5'- GGAAAAGACCACTTTCTGCTTAGTG -3'
Posted On2020-01-23