Incidental Mutation 'R8063:Cnot4'
ID619845
Institutional Source Beutler Lab
Gene Symbol Cnot4
Ensembl Gene ENSMUSG00000038784
Gene NameCCR4-NOT transcription complex, subunit 4
SynonymsNot4h, Not4, Not4hp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location35022065-35133724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35068643 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 211 (M211K)
Ref Sequence ENSEMBL: ENSMUSP00000110645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044163] [ENSMUST00000114989] [ENSMUST00000114993] [ENSMUST00000202143] [ENSMUST00000202417]
Predicted Effect probably damaging
Transcript: ENSMUST00000044163
AA Change: M211K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044137
Gene: ENSMUSG00000038784
AA Change: M211K

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114989
AA Change: M211K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110640
Gene: ENSMUSG00000038784
AA Change: M211K

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 537 549 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114993
AA Change: M211K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110645
Gene: ENSMUSG00000038784
AA Change: M211K

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 572 592 N/A INTRINSIC
low complexity region 644 658 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202143
AA Change: M211K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144352
Gene: ENSMUSG00000038784
AA Change: M211K

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202417
AA Change: M211K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144409
Gene: ENSMUSG00000038784
AA Change: M211K

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the CCR4-NOT complex, a global transcriptional regulator. The encoded protein interacts with CNOT1 and has E3 ubiquitin ligase activity. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Cnot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Cnot4 APN 6 35078114 missense probably damaging 1.00
IGL01341:Cnot4 APN 6 35070254 missense probably damaging 1.00
IGL01346:Cnot4 APN 6 35070248 missense probably damaging 1.00
IGL01775:Cnot4 APN 6 35069476 splice site probably benign
IGL02035:Cnot4 APN 6 35070251 missense probably damaging 1.00
IGL02167:Cnot4 APN 6 35056224 missense possibly damaging 0.49
IGL02227:Cnot4 APN 6 35051263 missense probably benign 0.44
IGL03136:Cnot4 APN 6 35051241 missense probably damaging 0.99
IGL03230:Cnot4 APN 6 35051409 missense probably damaging 1.00
IGL03297:Cnot4 APN 6 35024223 missense probably benign
R0049:Cnot4 UTSW 6 35051277 missense probably benign
R0049:Cnot4 UTSW 6 35051277 missense probably benign
R0597:Cnot4 UTSW 6 35051503 missense possibly damaging 0.66
R1518:Cnot4 UTSW 6 35051454 missense probably damaging 0.98
R1883:Cnot4 UTSW 6 35078157 missense probably damaging 0.99
R1884:Cnot4 UTSW 6 35078157 missense probably damaging 0.99
R1992:Cnot4 UTSW 6 35023409 missense probably benign
R3500:Cnot4 UTSW 6 35080141 start gained probably benign
R4738:Cnot4 UTSW 6 35051376 missense probably benign 0.28
R5029:Cnot4 UTSW 6 35078027 missense probably damaging 1.00
R5247:Cnot4 UTSW 6 35051416 missense probably damaging 0.96
R5534:Cnot4 UTSW 6 35078004 missense possibly damaging 0.55
R5602:Cnot4 UTSW 6 35051529 nonsense probably null
R6236:Cnot4 UTSW 6 35068673 missense probably benign 0.33
R6701:Cnot4 UTSW 6 35068604 missense probably damaging 1.00
R7252:Cnot4 UTSW 6 35069427 missense probably damaging 1.00
R7360:Cnot4 UTSW 6 35065006 missense probably damaging 1.00
R7479:Cnot4 UTSW 6 35024148 missense probably benign 0.00
R7574:Cnot4 UTSW 6 35053004 missense possibly damaging 0.82
R8137:Cnot4 UTSW 6 35046287 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTAACCATGTCCACAGAAGAG -3'
(R):5'- CAGCTTCCTAGTGCTCTTAGTCATG -3'

Sequencing Primer
(F):5'- GTCCACAGAAGAGACATTTTATGAG -3'
(R):5'- AGTGCTCTTAGTCATGTTTTATTCTG -3'
Posted On2020-01-23