Incidental Mutation 'R8063:Tet3'
ID619848
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Nametet methylcytosine dioxygenase 3
SynonymsD230004J03Rik, B430006D22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83362373-83459084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83402741 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 815 (D815G)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]
Predicted Effect probably damaging
Transcript: ENSMUST00000089622
AA Change: D680G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: D680G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186548
AA Change: D815G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: D815G

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190295
SMART Domains Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83368655 missense probably benign 0.06
IGL01396:Tet3 APN 6 83369638 nonsense probably null
IGL02344:Tet3 APN 6 83403833 missense probably benign 0.04
IGL02987:Tet3 APN 6 83368092 missense probably damaging 0.99
IGL03126:Tet3 APN 6 83376787 missense probably damaging 1.00
IGL03155:Tet3 APN 6 83368383 missense probably damaging 1.00
IGL03286:Tet3 APN 6 83375778 missense probably damaging 1.00
Reedy UTSW 6 83368084 nonsense probably null
P0033:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R0131:Tet3 UTSW 6 83368788 missense probably damaging 1.00
R0295:Tet3 UTSW 6 83369139 missense probably benign 0.14
R0504:Tet3 UTSW 6 83373794 missense probably damaging 1.00
R0524:Tet3 UTSW 6 83379942 missense probably damaging 1.00
R1061:Tet3 UTSW 6 83373323 missense probably damaging 0.99
R1160:Tet3 UTSW 6 83404452 missense probably benign 0.00
R1550:Tet3 UTSW 6 83386028 missense probably damaging 0.97
R1640:Tet3 UTSW 6 83369315 missense probably benign 0.44
R1658:Tet3 UTSW 6 83369057 missense probably benign 0.44
R1746:Tet3 UTSW 6 83368068 missense probably damaging 1.00
R1761:Tet3 UTSW 6 83403659 missense probably damaging 0.99
R1832:Tet3 UTSW 6 83403645 missense probably benign
R1835:Tet3 UTSW 6 83404163 missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83404379 missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83386075 missense probably damaging 1.00
R2230:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2232:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2922:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R3429:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R3430:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R4291:Tet3 UTSW 6 83373199 missense probably damaging 1.00
R4349:Tet3 UTSW 6 83403275 missense probably benign
R4809:Tet3 UTSW 6 83402946 missense probably benign
R4846:Tet3 UTSW 6 83376883 nonsense probably null
R5039:Tet3 UTSW 6 83375896 missense probably damaging 1.00
R5233:Tet3 UTSW 6 83386063 missense probably damaging 1.00
R5363:Tet3 UTSW 6 83376764 critical splice donor site probably null
R5880:Tet3 UTSW 6 83370550 missense probably damaging 1.00
R6270:Tet3 UTSW 6 83375791 missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83368084 nonsense probably null
R6564:Tet3 UTSW 6 83386070 missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83403444 missense probably benign 0.00
R7089:Tet3 UTSW 6 83455024 missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83370621 missense probably damaging 1.00
R7251:Tet3 UTSW 6 83404056 missense probably benign
R7361:Tet3 UTSW 6 83368094 missense probably benign 0.15
R7436:Tet3 UTSW 6 83368229 small insertion probably benign
R7438:Tet3 UTSW 6 83368229 small insertion probably benign
R7544:Tet3 UTSW 6 83404641 missense probably damaging 1.00
R7552:Tet3 UTSW 6 83368307 missense probably damaging 1.00
R8010:Tet3 UTSW 6 83403246 missense unknown
R8307:Tet3 UTSW 6 83379927 missense probably damaging 1.00
X0004:Tet3 UTSW 6 83403423 missense probably benign 0.17
Z1176:Tet3 UTSW 6 83370698 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83404350 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83459021 missense unknown
Z1177:Tet3 UTSW 6 83404294 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTTCCCAGGACACAGCAAAGTG -3'
(R):5'- ATCAACATGTCTCCCAGCTC -3'

Sequencing Primer
(F):5'- AGTGGTAGGCATTTAGTAAACCGTC -3'
(R):5'- TCCGGAGAGCCCTTTTGC -3'
Posted On2020-01-23