Incidental Mutation 'R8063:Vmn2r26'
ID 619849
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 067499-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8063 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124001914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 66 (H66Q)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: H66Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: H66Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,862,190 (GRCm39) I248N possibly damaging Het
Agk T A 6: 40,306,490 (GRCm39) C20S possibly damaging Het
Alpk2 G A 18: 65,483,417 (GRCm39) S197L probably benign Het
Armc10 T C 5: 21,853,768 (GRCm39) probably null Het
Asxl2 A G 12: 3,550,768 (GRCm39) T837A probably benign Het
Atp12a A G 14: 56,603,545 (GRCm39) E50G probably damaging Het
Bend5 G T 4: 111,317,031 (GRCm39) C398F probably damaging Het
Bicra A G 7: 15,712,969 (GRCm39) V1026A probably benign Het
Canx A T 11: 50,199,173 (GRCm39) Y165* probably null Het
Casp14 A G 10: 78,549,865 (GRCm39) F210L probably damaging Het
Cep70 T A 9: 99,178,175 (GRCm39) D458E probably benign Het
Cisd3 T C 11: 97,576,710 (GRCm39) V12A probably benign Het
Cnot4 A T 6: 35,045,578 (GRCm39) M211K probably damaging Het
Cyp4f18 A G 8: 72,752,075 (GRCm39) L197P probably damaging Het
Dnah5 T A 15: 28,230,729 (GRCm39) I209N probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Edem2 A T 2: 155,544,376 (GRCm39) M458K probably benign Het
Eif2ak4 G A 2: 118,241,382 (GRCm39) E178K possibly damaging Het
Fars2 G A 13: 36,388,880 (GRCm39) W123* probably null Het
Ighv1-20 T C 12: 114,687,405 (GRCm39) Y113C probably damaging Het
Il18r1 T A 1: 40,526,198 (GRCm39) I248N probably benign Het
Impg2 T A 16: 56,081,819 (GRCm39) probably benign Het
Kcnh2 T C 5: 24,526,670 (GRCm39) E1042G probably benign Het
Krt42 G C 11: 100,155,865 (GRCm39) R294G possibly damaging Het
Lasp1 T C 11: 97,724,957 (GRCm39) Y188H probably benign Het
Lrrc37 T C 11: 103,433,087 (GRCm39) T3361A unknown Het
Lrrc52 A G 1: 167,294,090 (GRCm39) I65T probably damaging Het
Megf9 A G 4: 70,406,495 (GRCm39) C224R probably damaging Het
Ms4a10 T C 19: 10,942,136 (GRCm39) T162A probably benign Het
Mstn T A 1: 53,105,607 (GRCm39) F316L probably benign Het
Ndufs8 T C 19: 3,961,019 (GRCm39) Y86C probably damaging Het
Or10d4b A T 9: 39,534,823 (GRCm39) I133F probably damaging Het
Pappa2 C T 1: 158,764,126 (GRCm39) D462N possibly damaging Het
Rad51d A G 11: 82,780,597 (GRCm39) S62P probably benign Het
Ralgapa2 A G 2: 146,285,775 (GRCm39) Y388H probably damaging Het
Rdm1 C A 11: 101,521,694 (GRCm39) Q150K probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Sctr T C 1: 119,991,005 (GRCm39) V446A probably benign Het
Sin3b G A 8: 73,452,169 (GRCm39) D71N probably damaging Het
Sirt5 A T 13: 43,524,323 (GRCm39) T32S probably benign Het
Slc17a1 T C 13: 24,059,524 (GRCm39) V85A probably benign Het
Snx1 C T 9: 66,004,676 (GRCm39) probably benign Het
Sorcs1 T A 19: 50,132,415 (GRCm39) D1181V unknown Het
Tcof1 A G 18: 60,971,834 (GRCm39) S158P probably damaging Het
Tet3 T C 6: 83,379,723 (GRCm39) D815G probably damaging Het
Tnfsf11 A T 14: 78,516,098 (GRCm39) I290N probably damaging Het
Uba6 A T 5: 86,300,544 (GRCm39) N225K probably benign Het
Usp30 A G 5: 114,238,524 (GRCm39) T11A probably benign Het
Vmn1r5 T G 6: 56,962,583 (GRCm39) M86R probably damaging Het
Vps13d T C 4: 144,841,327 (GRCm39) E2647G Het
Wdr5b T A 16: 35,862,158 (GRCm39) D92E possibly damaging Het
Zfp960 C A 17: 17,308,623 (GRCm39) R446S probably benign Het
Zscan20 C T 4: 128,480,028 (GRCm39) S821N probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCCAAGATTCTCAACTGAACAGA -3'
(R):5'- ACAAAGTCTTTTCAACAATGTCTTAC -3'

Sequencing Primer
(F):5'- AGTATGAAATTACTCACTGCTTTCTC -3'
(R):5'- AGCTTGTCTACACTCTAGAAGGTGTC -3'
Posted On 2020-01-23