Incidental Mutation 'R8063:Sin3b'
ID619852
Institutional Source Beutler Lab
Gene Symbol Sin3b
Ensembl Gene ENSMUSG00000031622
Gene Nametranscriptional regulator, SIN3B (yeast)
Synonyms2810430C10Rik
Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72723285-72758201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72725541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 71 (D71N)
Ref Sequence ENSEMBL: ENSMUSP00000004494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000109950] [ENSMUST00000212095] [ENSMUST00000212096]
PDB Structure
STRUCTURE OF THE COMPLEX OF THE MAD1-SIN3B INTERACTION DOMAINS [SOLUTION NMR]
Extended SID of Mad1 bound to the PAH2 domain of mSin3B [SOLUTION NMR]
Solution structure of the first PAH domain of the mouse transcriptional repressor SIN3B [SOLUTION NMR]
Solution structure of the NRSF/REST-mSin3B PAH1 complex [SOLUTION NMR]
Solution structure of free PAH2 domain of mSin3B [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000004494
AA Change: D71N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622
AA Change: D71N

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109950
AA Change: D71N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105576
Gene: ENSMUSG00000031622
AA Change: D71N

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 3.4e-20 PFAM
Pfam:PAH 173 227 5.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212095
AA Change: D71N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212096
AA Change: D92N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Sin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Sin3b APN 8 72757000 missense probably benign 0.22
IGL01107:Sin3b APN 8 72731105 missense possibly damaging 0.74
IGL01114:Sin3b APN 8 72744505 missense probably benign 0.06
IGL01603:Sin3b APN 8 72750064 missense probably damaging 1.00
IGL01763:Sin3b APN 8 72746608 missense probably damaging 1.00
IGL02078:Sin3b APN 8 72753580 missense possibly damaging 0.49
IGL02572:Sin3b APN 8 72744481 missense probably benign 0.15
IGL02732:Sin3b APN 8 72733453 missense possibly damaging 0.72
IGL02831:Sin3b APN 8 72744562 missense probably damaging 1.00
IGL03064:Sin3b APN 8 72757058 unclassified probably benign
IGL03107:Sin3b APN 8 72753585 missense probably damaging 0.99
IGL03142:Sin3b APN 8 72744568 missense probably damaging 1.00
3-1:Sin3b UTSW 8 72753209 missense possibly damaging 0.95
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0226:Sin3b UTSW 8 72744508 missense probably benign 0.44
R0629:Sin3b UTSW 8 72753536 splice site probably benign
R1486:Sin3b UTSW 8 72750513 missense probably benign 0.00
R1524:Sin3b UTSW 8 72753287 missense probably benign 0.05
R1653:Sin3b UTSW 8 72741519 missense probably benign 0.30
R2144:Sin3b UTSW 8 72731265 missense probably damaging 1.00
R2180:Sin3b UTSW 8 72753295 nonsense probably null
R2271:Sin3b UTSW 8 72733419 missense probably benign 0.11
R2353:Sin3b UTSW 8 72724152 critical splice donor site probably null
R3945:Sin3b UTSW 8 72733439 missense possibly damaging 0.88
R4412:Sin3b UTSW 8 72739779 missense probably benign 0.16
R4564:Sin3b UTSW 8 72753581 missense probably damaging 1.00
R4782:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4799:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4863:Sin3b UTSW 8 72744948 missense possibly damaging 0.91
R5011:Sin3b UTSW 8 72744556 missense probably benign 0.39
R5237:Sin3b UTSW 8 72733343 critical splice acceptor site probably null
R5325:Sin3b UTSW 8 72750526 missense probably damaging 1.00
R5725:Sin3b UTSW 8 72725692 critical splice donor site probably null
R5927:Sin3b UTSW 8 72749878 missense probably benign 0.00
R5945:Sin3b UTSW 8 72731165 missense probably damaging 0.97
R6492:Sin3b UTSW 8 72733490 critical splice donor site probably null
R7092:Sin3b UTSW 8 72747870 critical splice donor site probably null
R7106:Sin3b UTSW 8 72724137 missense possibly damaging 0.90
R7258:Sin3b UTSW 8 72750208 missense probably benign 0.00
R7472:Sin3b UTSW 8 72753225 missense probably damaging 1.00
R7475:Sin3b UTSW 8 72749872 missense possibly damaging 0.47
R7491:Sin3b UTSW 8 72746441 missense probably damaging 1.00
R7636:Sin3b UTSW 8 72747734 nonsense probably null
X0017:Sin3b UTSW 8 72731165 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACATGGTGGGGCCCATTTG -3'
(R):5'- GGTCCACATCACTCAAGCGAAG -3'

Sequencing Primer
(F):5'- GCATACCTTTAATCTCAGGCAGAGG -3'
(R):5'- GCATTAAACCCCACGATG -3'
Posted On2020-01-23