Incidental Mutation 'R8063:Olfr960'
ID619853
Institutional Source Beutler Lab
Gene Symbol Olfr960
Ensembl Gene ENSMUSG00000059867
Gene Nameolfactory receptor 960
SynonymsMOR224-12, GA_x6K02T2PVTD-33320043-33320987
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39621373-39624205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39623527 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 133 (I133F)
Ref Sequence ENSEMBL: ENSMUSP00000148949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077060] [ENSMUST00000216584]
Predicted Effect probably damaging
Transcript: ENSMUST00000077060
AA Change: I135F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076315
Gene: ENSMUSG00000059867
AA Change: I135F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.3e-48 PFAM
Pfam:7tm_1 41 288 1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216584
AA Change: I133F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Olfr960
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Olfr960 APN 9 39623365 missense probably benign 0.37
IGL03031:Olfr960 APN 9 39623398 missense probably damaging 1.00
IGL03199:Olfr960 APN 9 39623944 missense probably benign 0.02
R2510:Olfr960 UTSW 9 39623431 missense probably damaging 1.00
R4829:Olfr960 UTSW 9 39623438 missense probably damaging 1.00
R5039:Olfr960 UTSW 9 39623560 missense possibly damaging 0.68
R5394:Olfr960 UTSW 9 39623134 missense probably benign 0.20
R5934:Olfr960 UTSW 9 39623183 missense probably damaging 1.00
R6030:Olfr960 UTSW 9 39623341 missense probably damaging 1.00
R6030:Olfr960 UTSW 9 39623341 missense probably damaging 1.00
R7491:Olfr960 UTSW 9 39623972 missense possibly damaging 0.65
R7509:Olfr960 UTSW 9 39623327 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACATGGGCTTCTGTTCCAC -3'
(R):5'- ATTTGTGAAACCTACCCTCTGTGC -3'

Sequencing Primer
(F):5'- TGTTCCACTACAGCTCCCAAGATG -3'
(R):5'- CTGTGCTAGAGAGGAATCTTCAC -3'
Posted On2020-01-23