Incidental Mutation 'R8063:Casp14'
ID619855
Institutional Source Beutler Lab
Gene Symbol Casp14
Ensembl Gene ENSMUSG00000005355
Gene Namecaspase 14
Synonymsmini-ICE, MICE
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location78711991-78718294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78714031 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 210 (F210L)
Ref Sequence ENSEMBL: ENSMUSP00000005488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005488] [ENSMUST00000219237]
Predicted Effect probably damaging
Transcript: ENSMUST00000005488
AA Change: F210L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005488
Gene: ENSMUSG00000005355
AA Change: F210L

DomainStartEndE-ValueType
CASc 15 257 1.42e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000219237
AA Change: F210L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This caspase has been shown to be processed and activated by caspase 8 and caspase 10 in vitro, and by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may be involved in keratinocyte terminal differentiation, which is important for the formation of the skin barrier. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired skin barrier function, skin dehydration and increased damage in response to UVB irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Casp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Casp14 APN 10 78715403 missense probably damaging 1.00
IGL03205:Casp14 APN 10 78713339 makesense probably null
R2082:Casp14 UTSW 10 78715033 missense probably benign 0.01
R4717:Casp14 UTSW 10 78715124 missense probably benign 0.38
R4840:Casp14 UTSW 10 78713344 nonsense probably null
R5174:Casp14 UTSW 10 78715391 missense possibly damaging 0.58
R5591:Casp14 UTSW 10 78714345 missense unknown
R6797:Casp14 UTSW 10 78715141 missense possibly damaging 0.75
R7477:Casp14 UTSW 10 78714304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTATACAGATACATACCAC -3'
(R):5'- GCTCCTTCCCCATGAATCAG -3'

Sequencing Primer
(F):5'- TTGAGAGTCCCAGTGTGT -3'
(R):5'- TGAATCAGCACCCAAGATCCCTG -3'
Posted On2020-01-23