Mutagenetix > Incidental Mutation

Incidental Mutation 'R8063:Canx'

619856

Institutional Source

Beutler Lab

Gene Symbol

Canx

Ensembl Gene

ENSMUSG00000020368

Gene Name

calnexin

Synonyms

1110069N15Rik, CNX

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R8063 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50293961-50325673 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 50308346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 165 (Y165*)

Ref Sequence

ENSEMBL: ENSMUSP00000020637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]

AlphaFold

P35564

Predicted Effect

probably null
Transcript: ENSMUST00000020637
AA Change: Y165*

SMART Domains

Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: Y165*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	72	441	1.7e-170	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179865
AA Change: Y165*

SMART Domains

Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: Y165*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	70	441	4.7e-166	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,971,364	I248N	possibly damaging	Het
Agk	T	A	6: 40,329,556	C20S	possibly damaging	Het
Alpk2	G	A	18: 65,350,346	S197L	probably benign	Het
Armc10	T	C	5: 21,648,770		probably null	Het
Asxl2	A	G	12: 3,500,768	T837A	probably benign	Het
Atp12a	A	G	14: 56,366,088	E50G	probably damaging	Het
Bend5	G	T	4: 111,459,834	C398F	probably damaging	Het
Bicra	A	G	7: 15,979,044	V1026A	probably benign	Het
Casp14	A	G	10: 78,714,031	F210L	probably damaging	Het
Cep70	T	A	9: 99,296,122	D458E	probably benign	Het
Cisd3	T	C	11: 97,685,884	V12A	probably benign	Het
Cnot4	A	T	6: 35,068,643	M211K	probably damaging	Het
Cyp4f18	A	G	8: 71,998,231	L197P	probably damaging	Het
Dnah5	T	A	15: 28,230,583	I209N	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Edem2	A	T	2: 155,702,456	M458K	probably benign	Het
Eif2ak4	G	A	2: 118,410,901	E178K	possibly damaging	Het
Fars2	G	A	13: 36,204,897	W123*	probably null	Het
Gm884	T	C	11: 103,542,261	T3361A	unknown	Het
Ighv1-20	T	C	12: 114,723,785	Y113C	probably damaging	Het
Il18r1	T	A	1: 40,487,038	I248N	probably benign	Het
Impg2	T	A	16: 56,261,456		probably benign	Het
Kcnh2	T	C	5: 24,321,672	E1042G	probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Lasp1	T	C	11: 97,834,131	Y188H	probably benign	Het
Lrrc52	A	G	1: 167,466,521	I65T	probably damaging	Het
Megf9	A	G	4: 70,488,258	C224R	probably damaging	Het
Ms4a10	T	C	19: 10,964,772	T162A	probably benign	Het
Mstn	T	A	1: 53,066,448	F316L	probably benign	Het
Ndufs8	T	C	19: 3,911,019	Y86C	probably damaging	Het
Olfr960	A	T	9: 39,623,527	I133F	probably damaging	Het
Pappa2	C	T	1: 158,936,556	D462N	possibly damaging	Het
Rad51d	A	G	11: 82,889,771	S62P	probably benign	Het
Ralgapa2	A	G	2: 146,443,855	Y388H	probably damaging	Het
Rdm1	C	A	11: 101,630,868	Q150K	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Sctr	T	C	1: 120,063,275	V446A	probably benign	Het
Sin3b	G	A	8: 72,725,541	D71N	probably damaging	Het
Sirt5	A	T	13: 43,370,847	T32S	probably benign	Het
Slc17a1	T	C	13: 23,875,541	V85A	probably benign	Het
Snx1	C	T	9: 66,097,394		probably benign	Het
Sorcs1	T	A	19: 50,143,977	D1181V	unknown	Het
Tcof1	A	G	18: 60,838,762	S158P	probably damaging	Het
Tet3	T	C	6: 83,402,741	D815G	probably damaging	Het
Tnfsf11	A	T	14: 78,278,658	I290N	probably damaging	Het
Uba6	A	T	5: 86,152,685	N225K	probably benign	Het
Usp30	A	G	5: 114,100,463	T11A	probably benign	Het
Vmn1r5	T	G	6: 56,985,598	M86R	probably damaging	Het
Vmn2r26	T	A	6: 124,024,955	H66Q	probably benign	Het
Vps13d	T	C	4: 145,114,757	E2647G		Het
Wdr5b	T	A	16: 36,041,788	D92E	possibly damaging	Het
Zfp960	C	A	17: 17,088,361	R446S	probably benign	Het
Zscan20	C	T	4: 128,586,235	S821N	probably benign	Het

Other mutations in Canx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Canx	APN	11	50300996	missense	possibly damaging	0.61
IGL03089:Canx	APN	11	50304482	missense	possibly damaging	0.85
R1428:Canx	UTSW	11	50308394	splice site	probably benign
R1876:Canx	UTSW	11	50304359	missense	probably damaging	1.00
R2057:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2058:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2088:Canx	UTSW	11	50310390	missense	possibly damaging	0.89
R2126:Canx	UTSW	11	50304358	missense	probably damaging	1.00
R2217:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2218:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2386:Canx	UTSW	11	50297106	missense	probably benign
R3716:Canx	UTSW	11	50304474	missense	probably benign	0.14
R3957:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R4019:Canx	UTSW	11	50299245	missense	probably damaging	1.00
R4402:Canx	UTSW	11	50304438	missense	probably benign	0.13
R4825:Canx	UTSW	11	50308809	missense	probably benign	0.42
R5252:Canx	UTSW	11	50308794	missense	probably damaging	1.00
R5385:Canx	UTSW	11	50301812	missense	probably damaging	1.00
R5797:Canx	UTSW	11	50301017	missense	probably benign	0.00
R5820:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R6052:Canx	UTSW	11	50297119	missense	possibly damaging	0.49
R7259:Canx	UTSW	11	50301816	missense	probably damaging	1.00
R7603:Canx	UTSW	11	50311628	missense	probably benign
R7715:Canx	UTSW	11	50310804	missense	probably benign	0.13
R7735:Canx	UTSW	11	50301039	missense	probably damaging	0.97
R8069:Canx	UTSW	11	50311704	missense	possibly damaging	0.93
R8494:Canx	UTSW	11	50311782	critical splice acceptor site	probably null
R8508:Canx	UTSW	11	50311647	missense	possibly damaging	0.85
R8941:Canx	UTSW	11	50304443	missense	possibly damaging	0.90
R9153:Canx	UTSW	11	50297335	missense	probably benign
R9722:Canx	UTSW	11	50304474	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GTGCCAAGTCTCCATGGTTC -3'
(R):5'- AGACAATGGAACCTTTTGTGTG -3'

Sequencing Primer
(F):5'- GGTTCACCAGCAGCAGCATTTC -3'
(R):5'- GTGTGGGTATGACATCTGATAAAAC -3'

Posted On

2020-01-23