Incidental Mutation 'R8063:Rdm1'
ID619861
Institutional Source Beutler Lab
Gene Symbol Rdm1
Ensembl Gene ENSMUSG00000010362
Gene NameRAD52 motif 1
SynonymsRad52b, 2410008M22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101627195-101636100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101630868 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 150 (Q150K)
Ref Sequence ENSEMBL: ENSMUSP00000010506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010506]
Predicted Effect probably benign
Transcript: ENSMUST00000010506
AA Change: Q150K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010506
Gene: ENSMUSG00000010362
AA Change: Q150K

DomainStartEndE-ValueType
RRM 16 94 6.2e-6 SMART
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083833
Predicted Effect
SMART Domains Protein: ENSMUSP00000118996
Gene: ENSMUSG00000010362
AA Change: Q79K

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 14 118 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155222
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Rdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Rdm1 APN 11 101635754 missense possibly damaging 0.58
IGL02153:Rdm1 APN 11 101628454 critical splice donor site probably null
IGL02589:Rdm1 APN 11 101628005 missense possibly damaging 0.80
R0532:Rdm1 UTSW 11 101635835 missense probably benign 0.11
R1111:Rdm1 UTSW 11 101633895 missense probably benign 0.19
R1532:Rdm1 UTSW 11 101633817 missense probably damaging 1.00
R1618:Rdm1 UTSW 11 101628391 missense possibly damaging 0.83
R1696:Rdm1 UTSW 11 101630868 missense probably benign 0.43
R2205:Rdm1 UTSW 11 101634803 missense probably damaging 1.00
R2921:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2922:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2923:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R4327:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R4329:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R6364:Rdm1 UTSW 11 101630242 missense probably benign 0.01
R7109:Rdm1 UTSW 11 101633828 missense probably damaging 1.00
X0010:Rdm1 UTSW 11 101627970 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGAGTTCTCCAGCAAGC -3'
(R):5'- CTGGCTAGTAGCTGACAACAAGTG -3'

Sequencing Primer
(F):5'- TGGTTCTCAGAGAGAAGG -3'
(R):5'- CTAGTAGCTGACAACAAGTGGAGAG -3'
Posted On2020-01-23