Incidental Mutation 'R8063:Fars2'
ID619867
Institutional Source Beutler Lab
Gene Symbol Fars2
Ensembl Gene ENSMUSG00000021420
Gene Namephenylalanine-tRNA synthetase 2 (mitochondrial)
Synonyms2810431B21Rik, Fars1, 6720478K01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8063 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location36117412-36726280 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36204897 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 123 (W123*)
Ref Sequence ENSEMBL: ENSMUSP00000021857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021857] [ENSMUST00000099582] [ENSMUST00000223796] [ENSMUST00000224241] [ENSMUST00000224611] [ENSMUST00000224916]
Predicted Effect probably null
Transcript: ENSMUST00000021857
AA Change: W123*
SMART Domains Protein: ENSMUSP00000021857
Gene: ENSMUSG00000021420
AA Change: W123*

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 69 208 3.3e-18 PFAM
Pfam:tRNA-synt_2d 223 343 9.5e-31 PFAM
FDX-ACB 358 450 1.5e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099582
SMART Domains Protein: ENSMUSP00000097177
Gene: ENSMUSG00000021420

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 4 111 2.6e-33 PFAM
FDX-ACB 126 218 1.5e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223796
AA Change: W123*
Predicted Effect probably null
Transcript: ENSMUST00000224241
AA Change: W123*
Predicted Effect probably null
Transcript: ENSMUST00000224611
AA Change: W123*
Predicted Effect probably null
Transcript: ENSMUST00000224916
AA Change: W123*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Fars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Fars2 APN 13 36537311 missense probably benign 0.07
IGL02348:Fars2 APN 13 36537380 missense probably benign 0.00
IGL02406:Fars2 APN 13 36410162 missense probably benign 0.39
IGL02523:Fars2 APN 13 36204693 missense probably damaging 1.00
IGL02896:Fars2 APN 13 36204842 missense probably benign 0.02
IGL03299:Fars2 APN 13 36537410 nonsense probably null
IGL03308:Fars2 APN 13 36204687 missense possibly damaging 0.95
R0419:Fars2 UTSW 13 36537311 missense probably benign 0.07
R0546:Fars2 UTSW 13 36204586 missense probably benign 0.01
R1918:Fars2 UTSW 13 36204546 missense probably damaging 1.00
R3120:Fars2 UTSW 13 36246417 missense probably damaging 1.00
R3844:Fars2 UTSW 13 36205101 missense probably damaging 1.00
R4716:Fars2 UTSW 13 36205068 missense probably damaging 1.00
R4795:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4796:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4979:Fars2 UTSW 13 36204581 missense possibly damaging 0.54
R5262:Fars2 UTSW 13 36342018 missense probably damaging 1.00
R5413:Fars2 UTSW 13 36204562 nonsense probably null
R5475:Fars2 UTSW 13 36204570 missense probably benign
R5635:Fars2 UTSW 13 36410146 missense probably damaging 0.99
R6437:Fars2 UTSW 13 36204863 missense possibly damaging 0.80
R7637:Fars2 UTSW 13 36204775 missense probably benign 0.40
R7676:Fars2 UTSW 13 36205043 missense probably benign 0.07
R8013:Fars2 UTSW 13 36205085 nonsense probably null
R8014:Fars2 UTSW 13 36205085 nonsense probably null
X0020:Fars2 UTSW 13 36204795 missense probably damaging 1.00
Z1177:Fars2 UTSW 13 36204731 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAGTGTGCTGGAGATAC -3'
(R):5'- ATCAATCTGGTCACGACGATACAC -3'

Sequencing Primer
(F):5'- GCTGGAGATACTTGGTAAATCCTAC -3'
(R):5'- GATACACGTCACCTACCACAAGG -3'
Posted On2020-01-23