Incidental Mutation 'R8063:Sirt5'
ID 619868
Institutional Source Beutler Lab
Gene Symbol Sirt5
Ensembl Gene ENSMUSG00000054021
Gene Name sirtuin 5
Synonyms 0610012J09Rik, 1500032M05Rik
MMRRC Submission 067499-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8063 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 43518972-43548679 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43524323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 32 (T32S)
Ref Sequence ENSEMBL: ENSMUSP00000152796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066804] [ENSMUST00000220458] [ENSMUST00000220576] [ENSMUST00000220645] [ENSMUST00000221481] [ENSMUST00000221515] [ENSMUST00000223194]
AlphaFold Q8K2C6
Predicted Effect probably benign
Transcript: ENSMUST00000066804
AA Change: T32S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071048
Gene: ENSMUSG00000054021
AA Change: T32S

DomainStartEndE-ValueType
Pfam:SIR2 58 256 5.3e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220458
AA Change: T32S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000220576
AA Change: T32S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000220645
AA Change: T32S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000221481
AA Change: T32S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000221515
AA Change: T32S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000223194
AA Change: T32S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly healthy and do not exhibit globally increased mitochondrial protein acetylation levels relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,862,190 (GRCm39) I248N possibly damaging Het
Agk T A 6: 40,306,490 (GRCm39) C20S possibly damaging Het
Alpk2 G A 18: 65,483,417 (GRCm39) S197L probably benign Het
Armc10 T C 5: 21,853,768 (GRCm39) probably null Het
Asxl2 A G 12: 3,550,768 (GRCm39) T837A probably benign Het
Atp12a A G 14: 56,603,545 (GRCm39) E50G probably damaging Het
Bend5 G T 4: 111,317,031 (GRCm39) C398F probably damaging Het
Bicra A G 7: 15,712,969 (GRCm39) V1026A probably benign Het
Canx A T 11: 50,199,173 (GRCm39) Y165* probably null Het
Casp14 A G 10: 78,549,865 (GRCm39) F210L probably damaging Het
Cep70 T A 9: 99,178,175 (GRCm39) D458E probably benign Het
Cisd3 T C 11: 97,576,710 (GRCm39) V12A probably benign Het
Cnot4 A T 6: 35,045,578 (GRCm39) M211K probably damaging Het
Cyp4f18 A G 8: 72,752,075 (GRCm39) L197P probably damaging Het
Dnah5 T A 15: 28,230,729 (GRCm39) I209N probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Edem2 A T 2: 155,544,376 (GRCm39) M458K probably benign Het
Eif2ak4 G A 2: 118,241,382 (GRCm39) E178K possibly damaging Het
Fars2 G A 13: 36,388,880 (GRCm39) W123* probably null Het
Ighv1-20 T C 12: 114,687,405 (GRCm39) Y113C probably damaging Het
Il18r1 T A 1: 40,526,198 (GRCm39) I248N probably benign Het
Impg2 T A 16: 56,081,819 (GRCm39) probably benign Het
Kcnh2 T C 5: 24,526,670 (GRCm39) E1042G probably benign Het
Krt42 G C 11: 100,155,865 (GRCm39) R294G possibly damaging Het
Lasp1 T C 11: 97,724,957 (GRCm39) Y188H probably benign Het
Lrrc37 T C 11: 103,433,087 (GRCm39) T3361A unknown Het
Lrrc52 A G 1: 167,294,090 (GRCm39) I65T probably damaging Het
Megf9 A G 4: 70,406,495 (GRCm39) C224R probably damaging Het
Ms4a10 T C 19: 10,942,136 (GRCm39) T162A probably benign Het
Mstn T A 1: 53,105,607 (GRCm39) F316L probably benign Het
Ndufs8 T C 19: 3,961,019 (GRCm39) Y86C probably damaging Het
Or10d4b A T 9: 39,534,823 (GRCm39) I133F probably damaging Het
Pappa2 C T 1: 158,764,126 (GRCm39) D462N possibly damaging Het
Rad51d A G 11: 82,780,597 (GRCm39) S62P probably benign Het
Ralgapa2 A G 2: 146,285,775 (GRCm39) Y388H probably damaging Het
Rdm1 C A 11: 101,521,694 (GRCm39) Q150K probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Sctr T C 1: 119,991,005 (GRCm39) V446A probably benign Het
Sin3b G A 8: 73,452,169 (GRCm39) D71N probably damaging Het
Slc17a1 T C 13: 24,059,524 (GRCm39) V85A probably benign Het
Snx1 C T 9: 66,004,676 (GRCm39) probably benign Het
Sorcs1 T A 19: 50,132,415 (GRCm39) D1181V unknown Het
Tcof1 A G 18: 60,971,834 (GRCm39) S158P probably damaging Het
Tet3 T C 6: 83,379,723 (GRCm39) D815G probably damaging Het
Tnfsf11 A T 14: 78,516,098 (GRCm39) I290N probably damaging Het
Uba6 A T 5: 86,300,544 (GRCm39) N225K probably benign Het
Usp30 A G 5: 114,238,524 (GRCm39) T11A probably benign Het
Vmn1r5 T G 6: 56,962,583 (GRCm39) M86R probably damaging Het
Vmn2r26 T A 6: 124,001,914 (GRCm39) H66Q probably benign Het
Vps13d T C 4: 144,841,327 (GRCm39) E2647G Het
Wdr5b T A 16: 35,862,158 (GRCm39) D92E possibly damaging Het
Zfp960 C A 17: 17,308,623 (GRCm39) R446S probably benign Het
Zscan20 C T 4: 128,480,028 (GRCm39) S821N probably benign Het
Other mutations in Sirt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Sirt5 APN 13 43,533,164 (GRCm39) missense probably damaging 1.00
R0584:Sirt5 UTSW 13 43,548,204 (GRCm39) splice site probably null
R0697:Sirt5 UTSW 13 43,539,052 (GRCm39) missense probably damaging 1.00
R1022:Sirt5 UTSW 13 43,524,245 (GRCm39) missense probably benign 0.05
R1024:Sirt5 UTSW 13 43,524,245 (GRCm39) missense probably benign 0.05
R1352:Sirt5 UTSW 13 43,548,283 (GRCm39) missense probably damaging 1.00
R1874:Sirt5 UTSW 13 43,524,267 (GRCm39) missense possibly damaging 0.92
R3552:Sirt5 UTSW 13 43,536,643 (GRCm39) missense probably damaging 1.00
R3778:Sirt5 UTSW 13 43,536,583 (GRCm39) critical splice acceptor site probably null
R5591:Sirt5 UTSW 13 43,525,317 (GRCm39) missense possibly damaging 0.67
R7188:Sirt5 UTSW 13 43,525,380 (GRCm39) missense possibly damaging 0.93
R7788:Sirt5 UTSW 13 43,536,623 (GRCm39) missense probably benign 0.43
R8347:Sirt5 UTSW 13 43,533,977 (GRCm39) missense probably benign 0.00
R8859:Sirt5 UTSW 13 43,524,327 (GRCm39) missense possibly damaging 0.75
R9339:Sirt5 UTSW 13 43,530,327 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCAACCAGCAAATGTTTGTACC -3'
(R):5'- CGCCTTTGTGTTTATGACCAGG -3'

Sequencing Primer
(F):5'- GTGAGACAAAGACACACTATGTATG -3'
(R):5'- TTTATGACCAGGCTGAACTGAGGC -3'
Posted On 2020-01-23