Incidental Mutation 'R8063:Dsc2'
ID619875
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8063 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20032274 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,971,364 I248N possibly damaging Het
Agk T A 6: 40,329,556 C20S possibly damaging Het
Alpk2 G A 18: 65,350,346 S197L probably benign Het
Armc10 T C 5: 21,648,770 probably null Het
Asxl2 A G 12: 3,500,768 T837A probably benign Het
Atp12a A G 14: 56,366,088 E50G probably damaging Het
Bend5 G T 4: 111,459,834 C398F probably damaging Het
Bicra A G 7: 15,979,044 V1026A probably benign Het
Canx A T 11: 50,308,346 Y165* probably null Het
Casp14 A G 10: 78,714,031 F210L probably damaging Het
Cep70 T A 9: 99,296,122 D458E probably benign Het
Cisd3 T C 11: 97,685,884 V12A probably benign Het
Cnot4 A T 6: 35,068,643 M211K probably damaging Het
Cyp4f18 A G 8: 71,998,231 L197P probably damaging Het
Dnah5 T A 15: 28,230,583 I209N probably benign Het
Edem2 A T 2: 155,702,456 M458K probably benign Het
Eif2ak4 G A 2: 118,410,901 E178K possibly damaging Het
Fars2 G A 13: 36,204,897 W123* probably null Het
Gm884 T C 11: 103,542,261 T3361A unknown Het
Ighv1-20 T C 12: 114,723,785 Y113C probably damaging Het
Il18r1 T A 1: 40,487,038 I248N probably benign Het
Impg2 T A 16: 56,261,456 probably benign Het
Kcnh2 T C 5: 24,321,672 E1042G probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Lasp1 T C 11: 97,834,131 Y188H probably benign Het
Lrrc52 A G 1: 167,466,521 I65T probably damaging Het
Megf9 A G 4: 70,488,258 C224R probably damaging Het
Ms4a10 T C 19: 10,964,772 T162A probably benign Het
Mstn T A 1: 53,066,448 F316L probably benign Het
Ndufs8 T C 19: 3,911,019 Y86C probably damaging Het
Olfr960 A T 9: 39,623,527 I133F probably damaging Het
Pappa2 C T 1: 158,936,556 D462N possibly damaging Het
Rad51d A G 11: 82,889,771 S62P probably benign Het
Ralgapa2 A G 2: 146,443,855 Y388H probably damaging Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Sctr T C 1: 120,063,275 V446A probably benign Het
Sin3b G A 8: 72,725,541 D71N probably damaging Het
Sirt5 A T 13: 43,370,847 T32S probably benign Het
Slc17a1 T C 13: 23,875,541 V85A probably benign Het
Snx1 C T 9: 66,097,394 probably benign Het
Sorcs1 T A 19: 50,143,977 D1181V unknown Het
Tcof1 A G 18: 60,838,762 S158P probably damaging Het
Tet3 T C 6: 83,402,741 D815G probably damaging Het
Tnfsf11 A T 14: 78,278,658 I290N probably damaging Het
Uba6 A T 5: 86,152,685 N225K probably benign Het
Usp30 A G 5: 114,100,463 T11A probably benign Het
Vmn1r5 T G 6: 56,985,598 M86R probably damaging Het
Vmn2r26 T A 6: 124,024,955 H66Q probably benign Het
Vps13d T C 4: 145,114,757 E2647G Het
Wdr5b T A 16: 36,041,788 D92E possibly damaging Het
Zfp960 C A 17: 17,088,361 R446S probably benign Het
Zscan20 C T 4: 128,586,235 S821N probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On2020-01-23