Incidental Mutation 'R8064:Cyp4a14'
ID 619890
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 067500-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8064 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115352155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 86 (C86S)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: C86S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: C86S

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 25,171,566 (GRCm39) V755D probably benign Het
Adgrb3 A T 1: 25,459,637 (GRCm39) probably null Het
Anapc2 T C 2: 25,166,418 (GRCm39) V395A probably benign Het
Apol11b A G 15: 77,519,417 (GRCm39) V221A not run Het
Arhgef28 T A 13: 98,115,002 (GRCm39) Y616F probably benign Het
Brdt C A 5: 107,525,862 (GRCm39) S905* probably null Het
Ccdc54 T A 16: 50,410,327 (GRCm39) H313L probably benign Het
Chuk A G 19: 44,071,115 (GRCm39) L530P probably damaging Het
Csl A T 10: 99,594,407 (GRCm39) N219K probably damaging Het
Cyp2j5 A G 4: 96,546,948 (GRCm39) S189P probably damaging Het
Dgkg TCTCCT TCT 16: 22,399,344 (GRCm39) probably null Het
F11 C T 8: 45,698,810 (GRCm39) G445S probably benign Het
Fer T A 17: 64,214,418 (GRCm39) I117N probably benign Het
Gpat3 A T 5: 101,039,522 (GRCm39) I290F probably benign Het
H2-M10.2 C T 17: 36,595,442 (GRCm39) V283M probably damaging Het
Hpse G A 5: 100,836,766 (GRCm39) P408S probably benign Het
Hyou1 T A 9: 44,296,882 (GRCm39) N515K possibly damaging Het
Idh1 A G 1: 65,205,338 (GRCm39) L209P probably damaging Het
Igkv16-104 A T 6: 68,402,875 (GRCm39) Y56F possibly damaging Het
Ins2 A G 7: 142,232,553 (GRCm39) L77P probably benign Het
Kcnn2 A T 18: 45,692,426 (GRCm39) M1L probably benign Het
Kdm3b A T 18: 34,946,460 (GRCm39) probably null Het
Lysmd4 T C 7: 66,873,398 (GRCm39) F11S probably damaging Het
Macf1 T A 4: 123,353,167 (GRCm39) D3625V possibly damaging Het
Mlkl T A 8: 112,038,700 (GRCm39) E459V probably benign Het
Nsd3 A T 8: 26,190,698 (GRCm39) K210* probably null Het
Or10ag57 C T 2: 87,218,853 (GRCm39) T268I probably benign Het
Or10q1b T C 19: 13,682,386 (GRCm39) F65S probably damaging Het
Or52n4 T A 7: 104,294,561 (GRCm39) Q6L probably benign Het
Pcsk5 T C 19: 17,692,225 (GRCm39) N153S probably damaging Het
Rac3 T A 11: 120,614,401 (GRCm39) V182E probably benign Het
Ripk3 T G 14: 56,025,383 (GRCm39) E60D possibly damaging Het
Sacs T A 14: 61,429,624 (GRCm39) I561N possibly damaging Het
Smad7 A G 18: 75,527,153 (GRCm39) Y333C probably damaging Het
Snhg11 T G 2: 158,218,121 (GRCm39) M1R probably null Het
Sp100 C T 1: 85,608,860 (GRCm39) R330* probably null Het
Spen T C 4: 141,203,011 (GRCm39) K1872R possibly damaging Het
Spon1 T A 7: 113,635,856 (GRCm39) I690N probably damaging Het
Taok1 G A 11: 77,440,130 (GRCm39) R626* probably null Het
Tecta C T 9: 42,306,251 (GRCm39) G59D possibly damaging Het
Tmem8b T C 4: 43,690,139 (GRCm39) F399S probably damaging Het
Trank1 C T 9: 111,181,144 (GRCm39) Q389* probably null Het
Vmn1r33 G T 6: 66,588,911 (GRCm39) S214R probably benign Het
Vmn2r25 A T 6: 123,800,581 (GRCm39) L587* probably null Het
Vps35l T C 7: 118,353,147 (GRCm39) I238T probably damaging Het
Zfp335 G A 2: 164,749,620 (GRCm39) T259I probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGTTGGTCTCTGGACAGAAAG -3'
(R):5'- TTTCTTGAACATGCCAGAGTTATGC -3'

Sequencing Primer
(F):5'- TTGGTCTCTGGACAGAAAGAATGG -3'
(R):5'- ACATGCCAGAGTTATGCCCCTG -3'
Posted On 2020-01-23