Mutagenetix > Incidental Mutation

Incidental Mutation 'R8064:Spen'

619892

Institutional Source

Beutler Lab

Gene Symbol

Spen

Ensembl Gene

ENSMUSG00000040761

Gene Name

spen family transcription repressor

Synonyms

Mint

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8064 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141467890-141538597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141475700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1872 (K1872R)

Ref Sequence

ENSEMBL: ENSMUSP00000101412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078886
AA Change: K1849R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: K1849R

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	617	632	N/A	INTRINSIC
low complexity region	669	691	N/A	INTRINSIC
low complexity region	695	720	N/A	INTRINSIC
low complexity region	749	773	N/A	INTRINSIC
coiled coil region	800	825	N/A	INTRINSIC
low complexity region	830	841	N/A	INTRINSIC
internal_repeat_2	844	954	6.27e-5	PROSPERO
coiled coil region	1494	1522	N/A	INTRINSIC
low complexity region	1587	1627	N/A	INTRINSIC
low complexity region	1635	1641	N/A	INTRINSIC
low complexity region	1642	1671	N/A	INTRINSIC
low complexity region	1747	1758	N/A	INTRINSIC
low complexity region	1810	1823	N/A	INTRINSIC
low complexity region	1888	1903	N/A	INTRINSIC
low complexity region	1940	1955	N/A	INTRINSIC
low complexity region	2003	2012	N/A	INTRINSIC
internal_repeat_2	2015	2115	6.27e-5	PROSPERO
low complexity region	2127	2147	N/A	INTRINSIC
low complexity region	2169	2191	N/A	INTRINSIC
low complexity region	2207	2219	N/A	INTRINSIC
low complexity region	2304	2323	N/A	INTRINSIC
low complexity region	2332	2371	N/A	INTRINSIC
low complexity region	2396	2413	N/A	INTRINSIC
low complexity region	2518	2533	N/A	INTRINSIC
low complexity region	2545	2555	N/A	INTRINSIC
low complexity region	2696	2722	N/A	INTRINSIC
low complexity region	2931	2942	N/A	INTRINSIC
low complexity region	2994	3006	N/A	INTRINSIC
low complexity region	3192	3212	N/A	INTRINSIC
low complexity region	3299	3337	N/A	INTRINSIC
Pfam:SPOC	3465	3586	2.7e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105786
AA Change: K1872R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: K1872R

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	692	714	N/A	INTRINSIC
low complexity region	718	743	N/A	INTRINSIC
low complexity region	772	796	N/A	INTRINSIC
coiled coil region	823	848	N/A	INTRINSIC
low complexity region	853	864	N/A	INTRINSIC
internal_repeat_2	867	977	8.58e-5	PROSPERO
coiled coil region	1517	1545	N/A	INTRINSIC
low complexity region	1610	1650	N/A	INTRINSIC
low complexity region	1658	1664	N/A	INTRINSIC
low complexity region	1665	1694	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1833	1846	N/A	INTRINSIC
low complexity region	1911	1926	N/A	INTRINSIC
low complexity region	1963	1978	N/A	INTRINSIC
low complexity region	2026	2035	N/A	INTRINSIC
internal_repeat_2	2038	2138	8.58e-5	PROSPERO
low complexity region	2150	2170	N/A	INTRINSIC
low complexity region	2192	2214	N/A	INTRINSIC
low complexity region	2230	2242	N/A	INTRINSIC
low complexity region	2327	2346	N/A	INTRINSIC
low complexity region	2355	2394	N/A	INTRINSIC
low complexity region	2419	2436	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2568	2578	N/A	INTRINSIC
low complexity region	2719	2745	N/A	INTRINSIC
low complexity region	2954	2965	N/A	INTRINSIC
low complexity region	3017	3029	N/A	INTRINSIC
low complexity region	3215	3235	N/A	INTRINSIC
low complexity region	3322	3360	N/A	INTRINSIC
Pfam:SPOC	3488	3609	2.7e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147227

Meta Mutation Damage Score

0.1176

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,753,924	I238T	probably damaging	Het
Adam3	A	T	8: 24,681,550	V755D	probably benign	Het
Adgrb3	A	T	1: 25,420,556		probably null	Het
Anapc2	T	C	2: 25,276,406	V395A	probably benign	Het
Apol11b	A	G	15: 77,635,217	V221A	not run	Het
Arhgef28	T	A	13: 97,978,494	Y616F	probably benign	Het
Brdt	C	A	5: 107,377,996	S905*	probably null	Het
Ccdc54	T	A	16: 50,589,964	H313L	probably benign	Het
Chuk	A	G	19: 44,082,676	L530P	probably damaging	Het
Csl	A	T	10: 99,758,545	N219K	probably damaging	Het
Cyp2j5	A	G	4: 96,658,711	S189P	probably damaging	Het
Cyp4a14	A	T	4: 115,494,958	C86S	probably benign	Het
Dgkg	TCTCCT	TCT	16: 22,580,594		probably null	Het
F11	C	T	8: 45,245,773	G445S	probably benign	Het
Fer	T	A	17: 63,907,423	I117N	probably benign	Het
Gpat3	A	T	5: 100,891,656	I290F	probably benign	Het
H2-M10.2	C	T	17: 36,284,550	V283M	probably damaging	Het
Hpse	G	A	5: 100,688,900	P408S	probably benign	Het
Hyou1	T	A	9: 44,385,585	N515K	possibly damaging	Het
Idh1	A	G	1: 65,166,179	L209P	probably damaging	Het
Igkv16-104	A	T	6: 68,425,891	Y56F	possibly damaging	Het
Ins2	A	G	7: 142,678,816	L77P	probably benign	Het
Kcnn2	A	T	18: 45,559,359	M1L	probably benign	Het
Kdm3b	A	T	18: 34,813,407		probably null	Het
Lysmd4	T	C	7: 67,223,650	F11S	probably damaging	Het
Macf1	T	A	4: 123,459,374	D3625V	possibly damaging	Het
Mlkl	T	A	8: 111,312,068	E459V	probably benign	Het
Nsd3	A	T	8: 25,700,670	K210*	probably null	Het
Olfr1122	C	T	2: 87,388,509	T268I	probably benign	Het
Olfr1491	T	C	19: 13,705,022	F65S	probably damaging	Het
Olfr658	T	A	7: 104,645,354	Q6L	probably benign	Het
Pcsk5	T	C	19: 17,714,861	N153S	probably damaging	Het
Rac3	T	A	11: 120,723,575	V182E	probably benign	Het
Ripk3	T	G	14: 55,787,926	E60D	possibly damaging	Het
Sacs	T	A	14: 61,192,175	I561N	possibly damaging	Het
Smad7	A	G	18: 75,394,082	Y333C	probably damaging	Het
Snhg11	T	G	2: 158,376,201	M1R	probably null	Het
Sp100	C	T	1: 85,681,139	R330*	probably null	Het
Spon1	T	A	7: 114,036,621	I690N	probably damaging	Het
Taok1	G	A	11: 77,549,304	R626*	probably null	Het
Tecta	C	T	9: 42,394,955	G59D	possibly damaging	Het
Tmem8b	T	C	4: 43,690,139	F399S	probably damaging	Het
Trank1	C	T	9: 111,352,076	Q389*	probably null	Het
Vmn1r33	G	T	6: 66,611,927	S214R	probably benign	Het
Vmn2r25	A	T	6: 123,823,622	L587*	probably null	Het
Zfp335	G	A	2: 164,907,700	T259I	probably damaging	Het

Other mutations in Spen

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Spen	APN	4	141489901	missense	unknown
IGL01357:Spen	APN	4	141517113	missense	unknown
IGL02184:Spen	APN	4	141487606	missense	unknown
IGL02226:Spen	APN	4	141478146	missense	unknown
IGL02321:Spen	APN	4	141517130	missense	unknown
IGL02350:Spen	APN	4	141477579	missense	unknown
IGL02357:Spen	APN	4	141477579	missense	unknown
IGL02627:Spen	APN	4	141473015	missense	probably damaging	0.99
IGL02683:Spen	APN	4	141471645	missense	probably benign	0.06
IGL02945:Spen	APN	4	141494313	missense	unknown
IGL02950:Spen	APN	4	141469508	missense	probably damaging	1.00
IGL03008:Spen	APN	4	141476137	missense	possibly damaging	0.70
IGL03019:Spen	APN	4	141478916	missense	unknown
IGL03038:Spen	APN	4	141538239	missense	unknown
IGL03334:Spen	APN	4	141469969	missense	probably damaging	1.00
filtered	UTSW	4	141477372	missense	unknown
mentholated	UTSW	4	141469400	missense	possibly damaging	0.78
R0105:Spen	UTSW	4	141469810	splice site	probably benign
R0268:Spen	UTSW	4	141477557	missense	unknown
R0359:Spen	UTSW	4	141516870	missense	unknown
R0394:Spen	UTSW	4	141474203	missense	probably benign	0.03
R0423:Spen	UTSW	4	141479336	missense	unknown
R0433:Spen	UTSW	4	141483758	missense	unknown
R0462:Spen	UTSW	4	141473651	missense	probably damaging	1.00
R0687:Spen	UTSW	4	141488028	missense	unknown
R0699:Spen	UTSW	4	141474391	missense	possibly damaging	0.72
R0865:Spen	UTSW	4	141471870	missense	probably benign	0.11
R0918:Spen	UTSW	4	141485564	missense	unknown
R1034:Spen	UTSW	4	141475752	missense	probably benign	0.33
R1341:Spen	UTSW	4	141469400	missense	possibly damaging	0.78
R1401:Spen	UTSW	4	141471821	missense	probably damaging	0.98
R1509:Spen	UTSW	4	141475635	missense	probably benign	0.00
R1509:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R1561:Spen	UTSW	4	141472383	nonsense	probably null
R1589:Spen	UTSW	4	141488024	missense	unknown
R1640:Spen	UTSW	4	141468943	missense	probably damaging	0.98
R1758:Spen	UTSW	4	141476375	missense	unknown
R1764:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R1824:Spen	UTSW	4	141472785	missense	probably damaging	1.00
R1899:Spen	UTSW	4	141470343	missense	probably benign	0.17
R1916:Spen	UTSW	4	141472598	missense	probably damaging	1.00
R2011:Spen	UTSW	4	141473329	missense	probably damaging	1.00
R2295:Spen	UTSW	4	141477273	missense	unknown
R2379:Spen	UTSW	4	141516927	missense	unknown
R2404:Spen	UTSW	4	141477905	missense	unknown
R3719:Spen	UTSW	4	141517183	missense	unknown
R3889:Spen	UTSW	4	141477881	missense	unknown
R3945:Spen	UTSW	4	141477353	missense	unknown
R4227:Spen	UTSW	4	141522147	missense	unknown
R4326:Spen	UTSW	4	141477372	missense	unknown
R4382:Spen	UTSW	4	141473139	missense	possibly damaging	0.88
R4542:Spen	UTSW	4	141476786	missense	unknown
R4757:Spen	UTSW	4	141473079	nonsense	probably null
R4771:Spen	UTSW	4	141472596	missense	probably benign	0.14
R5072:Spen	UTSW	4	141522302	missense	unknown
R5121:Spen	UTSW	4	141476099	missense	probably benign	0.00
R5176:Spen	UTSW	4	141476276	missense	unknown
R5290:Spen	UTSW	4	141473816	missense	probably damaging	1.00
R5291:Spen	UTSW	4	141488079	missense	unknown
R5293:Spen	UTSW	4	141472406	missense	possibly damaging	0.89
R5347:Spen	UTSW	4	141471485	missense	probably benign	0.26
R5511:Spen	UTSW	4	141475064	missense	possibly damaging	0.86
R5511:Spen	UTSW	4	141516838	missense	unknown
R5772:Spen	UTSW	4	141478184	missense	unknown
R5834:Spen	UTSW	4	141471843	missense	possibly damaging	0.63
R5858:Spen	UTSW	4	141473871	missense	probably benign	0.05
R6214:Spen	UTSW	4	141479112	missense	unknown
R6232:Spen	UTSW	4	141517022	missense	unknown
R6345:Spen	UTSW	4	141471633	missense	possibly damaging	0.86
R6419:Spen	UTSW	4	141476310	missense	unknown
R6455:Spen	UTSW	4	141475509	missense	probably damaging	0.97
R6979:Spen	UTSW	4	141478063	missense	unknown
R6994:Spen	UTSW	4	141493459	missense	unknown
R7018:Spen	UTSW	4	141493444	missense	unknown
R7040:Spen	UTSW	4	141494382	missense	unknown
R7127:Spen	UTSW	4	141476108	missense	possibly damaging	0.53
R7218:Spen	UTSW	4	141472650	missense	possibly damaging	0.54
R7234:Spen	UTSW	4	141479135	missense	unknown
R7316:Spen	UTSW	4	141477054	missense	unknown
R7350:Spen	UTSW	4	141479385	missense	unknown
R7356:Spen	UTSW	4	141471924	nonsense	probably null
R7400:Spen	UTSW	4	141473741	missense	probably damaging	1.00
R7470:Spen	UTSW	4	141479294	missense	unknown
R7698:Spen	UTSW	4	141472845	missense	probably damaging	1.00
R7858:Spen	UTSW	4	141488131	splice site	probably null
R8033:Spen	UTSW	4	141471746	missense	probably benign	0.03
R8159:Spen	UTSW	4	141475003	missense	possibly damaging	0.53
R8187:Spen	UTSW	4	141472905	missense	possibly damaging	0.93
R8463:Spen	UTSW	4	141522279	missense	unknown
R8557:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8558:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8672:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8673:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8674:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8714:Spen	UTSW	4	141488003	missense	unknown
R8735:Spen	UTSW	4	141469818	missense	probably benign	0.32
R8762:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R8877:Spen	UTSW	4	141471826	nonsense	probably null
R8878:Spen	UTSW	4	141477209	missense	unknown
R8937:Spen	UTSW	4	141474063	missense	probably damaging	1.00
R8939:Spen	UTSW	4	141475658	missense	possibly damaging	0.72
R8968:Spen	UTSW	4	141470390	missense	probably benign	0.02
R8971:Spen	UTSW	4	141474578	missense	possibly damaging	0.53
R9016:Spen	UTSW	4	141473627	missense	probably damaging	1.00
R9072:Spen	UTSW	4	141476391	missense	unknown
R9073:Spen	UTSW	4	141476391	missense	unknown
R9120:Spen	UTSW	4	141472922	missense
R9136:Spen	UTSW	4	141522312	missense	unknown
R9138:Spen	UTSW	4	141469486	missense	probably damaging	1.00
R9150:Spen	UTSW	4	141517157	missense	unknown
R9225:Spen	UTSW	4	141475632	missense	possibly damaging	0.53
R9492:Spen	UTSW	4	141471787	missense	probably benign	0.26
R9537:Spen	UTSW	4	141471704	missense	probably benign	0.15
R9537:Spen	UTSW	4	141516845	small deletion	probably benign
R9602:Spen	UTSW	4	141477872	missense	unknown
R9609:Spen	UTSW	4	141488108	missense	unknown
R9686:Spen	UTSW	4	141472635	missense	probably benign	0.27
R9697:Spen	UTSW	4	141468964	missense	probably damaging	1.00
R9713:Spen	UTSW	4	141517020	missense	unknown
T0722:Spen	UTSW	4	141474353	missense	probably benign	0.33
T0975:Spen	UTSW	4	141474353	missense	probably benign	0.33
Z1088:Spen	UTSW	4	141477976	missense	unknown
Z1088:Spen	UTSW	4	141477977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGCATAAACACTCCTCACGTTC -3'
(R):5'- AACTGACTCAGAGGTCCGAG -3'

Sequencing Primer
(F):5'- ACTCCTCACGTTCCGGCG -3'
(R):5'- GTTGCATCAGAAGCTCAGC -3'

Posted On

2020-01-23