Incidental Mutation 'R8064:Spon1'
ID 619901
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R8064 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114036621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 690 (I690N)
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect probably damaging
Transcript: ENSMUST00000046687
AA Change: I690N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: I690N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,924 I238T probably damaging Het
Adam3 A T 8: 24,681,550 V755D probably benign Het
Adgrb3 A T 1: 25,420,556 probably null Het
Anapc2 T C 2: 25,276,406 V395A probably benign Het
Apol11b A G 15: 77,635,217 V221A not run Het
Arhgef28 T A 13: 97,978,494 Y616F probably benign Het
Brdt C A 5: 107,377,996 S905* probably null Het
Ccdc54 T A 16: 50,589,964 H313L probably benign Het
Chuk A G 19: 44,082,676 L530P probably damaging Het
Csl A T 10: 99,758,545 N219K probably damaging Het
Cyp2j5 A G 4: 96,658,711 S189P probably damaging Het
Cyp4a14 A T 4: 115,494,958 C86S probably benign Het
Dgkg TCTCCT TCT 16: 22,580,594 probably null Het
F11 C T 8: 45,245,773 G445S probably benign Het
Fer T A 17: 63,907,423 I117N probably benign Het
Gpat3 A T 5: 100,891,656 I290F probably benign Het
H2-M10.2 C T 17: 36,284,550 V283M probably damaging Het
Hpse G A 5: 100,688,900 P408S probably benign Het
Hyou1 T A 9: 44,385,585 N515K possibly damaging Het
Idh1 A G 1: 65,166,179 L209P probably damaging Het
Igkv16-104 A T 6: 68,425,891 Y56F possibly damaging Het
Ins2 A G 7: 142,678,816 L77P probably benign Het
Kcnn2 A T 18: 45,559,359 M1L probably benign Het
Kdm3b A T 18: 34,813,407 probably null Het
Lysmd4 T C 7: 67,223,650 F11S probably damaging Het
Macf1 T A 4: 123,459,374 D3625V possibly damaging Het
Mlkl T A 8: 111,312,068 E459V probably benign Het
Nsd3 A T 8: 25,700,670 K210* probably null Het
Olfr1122 C T 2: 87,388,509 T268I probably benign Het
Olfr1491 T C 19: 13,705,022 F65S probably damaging Het
Olfr658 T A 7: 104,645,354 Q6L probably benign Het
Pcsk5 T C 19: 17,714,861 N153S probably damaging Het
Rac3 T A 11: 120,723,575 V182E probably benign Het
Ripk3 T G 14: 55,787,926 E60D possibly damaging Het
Sacs T A 14: 61,192,175 I561N possibly damaging Het
Smad7 A G 18: 75,394,082 Y333C probably damaging Het
Snhg11 T G 2: 158,376,201 M1R probably null Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Taok1 G A 11: 77,549,304 R626* probably null Het
Tecta C T 9: 42,394,955 G59D possibly damaging Het
Tmem8b T C 4: 43,690,139 F399S probably damaging Het
Trank1 C T 9: 111,352,076 Q389* probably null Het
Vmn1r33 G T 6: 66,611,927 S214R probably benign Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zfp335 G A 2: 164,907,700 T259I probably damaging Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCACTGCTGCTAAAGACC -3'
(R):5'- GGAACTGCTCTCCATCTGACTC -3'

Sequencing Primer
(F):5'- ACTGCTGCTAAAGACCAGTTTC -3'
(R):5'- GACTCTTCTCTCAGCTGCTCAC -3'
Posted On 2020-01-23