Incidental Mutation 'R8064:Nsd3'
ID619905
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R8064 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 25700670 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 210 (K210*)
Ref Sequence ENSEMBL: ENSMUSP00000123028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]
Predicted Effect probably null
Transcript: ENSMUST00000084026
AA Change: K1161*
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: K1161*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139966
AA Change: K1112*
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: K1112*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142395
AA Change: K1161*
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: K1161*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153597
AA Change: K210*
SMART Domains Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823
AA Change: K210*

DomainStartEndE-ValueType
PWWP 17 79 8.62e-18 SMART
AWS 152 203 2.61e-17 SMART
SET 204 327 2.17e-41 SMART
PostSET 328 344 2.63e-3 SMART
low complexity region 358 375 N/A INTRINSIC
PHD 381 424 4.32e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,924 I238T probably damaging Het
Adam3 A T 8: 24,681,550 V755D probably benign Het
Adgrb3 A T 1: 25,420,556 probably null Het
Anapc2 T C 2: 25,276,406 V395A probably benign Het
Apol11b A G 15: 77,635,217 V221A not run Het
Arhgef28 T A 13: 97,978,494 Y616F probably benign Het
Brdt C A 5: 107,377,996 S905* probably null Het
Ccdc54 T A 16: 50,589,964 H313L probably benign Het
Chuk A G 19: 44,082,676 L530P probably damaging Het
Csl A T 10: 99,758,545 N219K probably damaging Het
Cyp2j5 A G 4: 96,658,711 S189P probably damaging Het
Cyp4a14 A T 4: 115,494,958 C86S probably benign Het
Dgkg TCTCCT TCT 16: 22,580,594 probably null Het
F11 C T 8: 45,245,773 G445S probably benign Het
Fer T A 17: 63,907,423 I117N probably benign Het
Gpat3 A T 5: 100,891,656 I290F probably benign Het
H2-M10.2 C T 17: 36,284,550 V283M probably damaging Het
Hpse G A 5: 100,688,900 P408S probably benign Het
Hyou1 T A 9: 44,385,585 N515K possibly damaging Het
Idh1 A G 1: 65,166,179 L209P probably damaging Het
Igkv16-104 A T 6: 68,425,891 Y56F possibly damaging Het
Ins2 A G 7: 142,678,816 L77P probably benign Het
Kcnn2 A T 18: 45,559,359 M1L probably benign Het
Kdm3b A T 18: 34,813,407 probably null Het
Lysmd4 T C 7: 67,223,650 F11S probably damaging Het
Macf1 T A 4: 123,459,374 D3625V possibly damaging Het
Mlkl T A 8: 111,312,068 E459V probably benign Het
Olfr1122 C T 2: 87,388,509 T268I probably benign Het
Olfr1491 T C 19: 13,705,022 F65S probably damaging Het
Olfr658 T A 7: 104,645,354 Q6L probably benign Het
Pcsk5 T C 19: 17,714,861 N153S probably damaging Het
Rac3 T A 11: 120,723,575 V182E probably benign Het
Ripk3 T G 14: 55,787,926 E60D possibly damaging Het
Sacs T A 14: 61,192,175 I561N possibly damaging Het
Smad7 A G 18: 75,394,082 Y333C probably damaging Het
Snhg11 T G 2: 158,376,201 M1R probably null Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spon1 T A 7: 114,036,621 I690N probably damaging Het
Taok1 G A 11: 77,549,304 R626* probably null Het
Tecta C T 9: 42,394,955 G59D possibly damaging Het
Tmem8b T C 4: 43,690,139 F399S probably damaging Het
Trank1 C T 9: 111,352,076 Q389* probably null Het
Vmn1r33 G T 6: 66,611,927 S214R probably benign Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zfp335 G A 2: 164,907,700 T259I probably damaging Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
R7678:Nsd3 UTSW 8 25659817 missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 25682562 missense probably benign
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCATAGGGAAGGTGCAGGTC -3'
(R):5'- GCCAGGCTGTTCTGTTATCC -3'

Sequencing Primer
(F):5'- TGGCTGACCTGTCGGAGATC -3'
(R):5'- AGGCTGTTCTGTTATCCTTTCCCAC -3'
Posted On2020-01-23