Mutagenetix > Incidental Mutations

Incidental Mutation 'R8064:Mlkl'

619907

Institutional Source

Beutler Lab

Gene Symbol

Mlkl

Ensembl Gene

ENSMUSG00000012519

Gene Name

mixed lineage kinase domain-like

Synonyms

9130019I15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R8064 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111311797-111338177 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111312068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 459 (E459V)

Ref Sequence

ENSEMBL: ENSMUSP00000055521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432]

AlphaFold

Q9D2Y4

PDB Structure

Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000056157
AA Change: E459V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: E459V

Domain	Start	End	E-Value	Type
low complexity region	109	115	N/A	INTRINSIC
Pfam:Pkinase_Tyr	195	448	2.7e-41	PFAM
Pfam:Pkinase	200	450	2.1e-30	PFAM
Pfam:Kinase-like	270	438	1.6e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120432
AA Change: E451V

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: E451V

Domain	Start	End	E-Value	Type
low complexity region	109	115	N/A	INTRINSIC
Pfam:Pkinase_Tyr	195	453	3.3e-42	PFAM
Pfam:Pkinase	196	453	1.4e-33	PFAM
Pfam:Kinase-like	270	438	8.9e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,753,924	I238T	probably damaging	Het
Adam3	A	T	8: 24,681,550	V755D	probably benign	Het
Adgrb3	A	T	1: 25,420,556		probably null	Het
Anapc2	T	C	2: 25,276,406	V395A	probably benign	Het
Apol11b	A	G	15: 77,635,217	V221A	not run	Het
Arhgef28	T	A	13: 97,978,494	Y616F	probably benign	Het
Brdt	C	A	5: 107,377,996	S905*	probably null	Het
Ccdc54	T	A	16: 50,589,964	H313L	probably benign	Het
Chuk	A	G	19: 44,082,676	L530P	probably damaging	Het
Csl	A	T	10: 99,758,545	N219K	probably damaging	Het
Cyp2j5	A	G	4: 96,658,711	S189P	probably damaging	Het
Cyp4a14	A	T	4: 115,494,958	C86S	probably benign	Het
Dgkg	TCTCCT	TCT	16: 22,580,594		probably null	Het
F11	C	T	8: 45,245,773	G445S	probably benign	Het
Fer	T	A	17: 63,907,423	I117N	probably benign	Het
Gpat3	A	T	5: 100,891,656	I290F	probably benign	Het
H2-M10.2	C	T	17: 36,284,550	V283M	probably damaging	Het
Hpse	G	A	5: 100,688,900	P408S	probably benign	Het
Hyou1	T	A	9: 44,385,585	N515K	possibly damaging	Het
Idh1	A	G	1: 65,166,179	L209P	probably damaging	Het
Igkv16-104	A	T	6: 68,425,891	Y56F	possibly damaging	Het
Ins2	A	G	7: 142,678,816	L77P	probably benign	Het
Kcnn2	A	T	18: 45,559,359	M1L	probably benign	Het
Kdm3b	A	T	18: 34,813,407		probably null	Het
Lysmd4	T	C	7: 67,223,650	F11S	probably damaging	Het
Macf1	T	A	4: 123,459,374	D3625V	possibly damaging	Het
Nsd3	A	T	8: 25,700,670	K210*	probably null	Het
Olfr1122	C	T	2: 87,388,509	T268I	probably benign	Het
Olfr1491	T	C	19: 13,705,022	F65S	probably damaging	Het
Olfr658	T	A	7: 104,645,354	Q6L	probably benign	Het
Pcsk5	T	C	19: 17,714,861	N153S	probably damaging	Het
Rac3	T	A	11: 120,723,575	V182E	probably benign	Het
Ripk3	T	G	14: 55,787,926	E60D	possibly damaging	Het
Sacs	T	A	14: 61,192,175	I561N	possibly damaging	Het
Smad7	A	G	18: 75,394,082	Y333C	probably damaging	Het
Snhg11	T	G	2: 158,376,201	M1R	probably null	Het
Sp100	C	T	1: 85,681,139	R330*	probably null	Het
Spen	T	C	4: 141,475,700	K1872R	possibly damaging	Het
Spon1	T	A	7: 114,036,621	I690N	probably damaging	Het
Taok1	G	A	11: 77,549,304	R626*	probably null	Het
Tecta	C	T	9: 42,394,955	G59D	possibly damaging	Het
Tmem8b	T	C	4: 43,690,139	F399S	probably damaging	Het
Trank1	C	T	9: 111,352,076	Q389*	probably null	Het
Vmn1r33	G	T	6: 66,611,927	S214R	probably benign	Het
Vmn2r25	A	T	6: 123,823,622	L587*	probably null	Het
Zfp335	G	A	2: 164,907,700	T259I	probably damaging	Het

Other mutations in Mlkl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Mlkl	APN	8	111319428	nonsense	probably null
IGL01376:Mlkl	APN	8	111319747	missense	probably damaging	1.00
IGL02801:Mlkl	APN	8	111316432	missense	probably benign	0.18
IGL02965:Mlkl	APN	8	111331837	missense	probably benign	0.31
IGL03121:Mlkl	APN	8	111314980	missense	probably damaging	1.00
Ghoulish	UTSW	8	111322748	missense	probably damaging	1.00
mecro	UTSW	8	111319716	critical splice donor site	probably null
necro	UTSW	8	111312100	intron	probably benign
secro	UTSW	8	111315567	intron	probably benign
R0133:Mlkl	UTSW	8	111327948	missense	probably damaging	1.00
R0230:Mlkl	UTSW	8	111315062	missense	probably benign	0.07
R0387:Mlkl	UTSW	8	111333350	missense	probably damaging	1.00
R0497:Mlkl	UTSW	8	111327873	missense	probably damaging	1.00
R0735:Mlkl	UTSW	8	111327801	unclassified	probably benign
R1733:Mlkl	UTSW	8	111322748	missense	probably damaging	1.00
R1761:Mlkl	UTSW	8	111333723	missense	possibly damaging	0.81
R1911:Mlkl	UTSW	8	111312100	intron	probably benign
R2057:Mlkl	UTSW	8	111333610	missense	probably benign	0.07
R2921:Mlkl	UTSW	8	111316447	missense	probably benign	0.02
R3745:Mlkl	UTSW	8	111315567	intron	probably benign
R4760:Mlkl	UTSW	8	111319716	critical splice donor site	probably null
R5377:Mlkl	UTSW	8	111327937	missense	probably benign	0.23
R7052:Mlkl	UTSW	8	111319442	missense	possibly damaging	0.65
R7155:Mlkl	UTSW	8	111319403	missense	probably damaging	1.00
R7459:Mlkl	UTSW	8	111333530	missense	probably benign	0.36
R7728:Mlkl	UTSW	8	111333619	missense	probably damaging	1.00
R8036:Mlkl	UTSW	8	111333454	missense	probably damaging	1.00
R9088:Mlkl	UTSW	8	111322733	missense
R9152:Mlkl	UTSW	8	111319771	missense	probably damaging	1.00
R9275:Mlkl	UTSW	8	111316423	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GGCTACATGGTGAGATCCCATC -3'
(R):5'- ACAAGCTGCTGATCCAGGTC -3'

Sequencing Primer
(F):5'- CCCAGCAATAAGTTGATGC -3'
(R):5'- GGTTATAGGCACGTACCATCATGC -3'

Posted On

2020-01-23