Incidental Mutation 'R0665:Gtf2h2'
ID 61991
Institutional Source Beutler Lab
Gene Symbol Gtf2h2
Ensembl Gene ENSMUSG00000021639
Gene Name general transcription factor II H, polypeptide 2
Synonyms Btf2p44, 44kDa, basal transcription factor 2, p44 subunit, p44
MMRRC Submission 038850-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0665 (G1)
Quality Score 207
Status Not validated
Chromosome 13
Chromosomal Location 100596726-100629087 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100617562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 200 (G200E)
Ref Sequence ENSEMBL: ENSMUSP00000138108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066940] [ENSMUST00000066984] [ENSMUST00000134842] [ENSMUST00000145266]
AlphaFold Q9JIB4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066940
SMART Domains Protein: ENSMUSP00000064590
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:VWA_2 60 166 5e-9 PFAM
Pfam:Ssl1 64 166 1.1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066984
AA Change: G200E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065228
Gene: ENSMUSG00000021639
AA Change: G200E

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124698
Predicted Effect probably benign
Transcript: ENSMUST00000134842
SMART Domains Protein: ENSMUSP00000138748
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:Ssl1 64 139 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142182
Predicted Effect probably damaging
Transcript: ENSMUST00000145266
AA Change: G200E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138108
Gene: ENSMUSG00000021639
AA Change: G200E

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232450
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,631,554 (GRCm39) Y304C probably damaging Het
B3galt2 T C 1: 143,522,191 (GRCm39) V109A possibly damaging Het
Chml T A 1: 175,515,461 (GRCm39) E153D probably benign Het
Dap3 A T 3: 88,838,304 (GRCm39) C78* probably null Het
Dnah8 T C 17: 30,955,129 (GRCm39) F2053L probably damaging Het
Dppa3 A G 6: 122,606,939 (GRCm39) E143G probably damaging Het
Espnl T G 1: 91,262,409 (GRCm39) probably null Het
Fat3 C T 9: 15,908,698 (GRCm39) A2435T probably benign Het
Flnc G A 6: 29,455,530 (GRCm39) V2027M probably damaging Het
Gtpbp1 A G 15: 79,597,648 (GRCm39) I348V probably benign Het
Kansl1 A G 11: 104,234,364 (GRCm39) V714A probably benign Het
Kcnk10 T C 12: 98,406,944 (GRCm39) I251V probably benign Het
Kri1 G A 9: 21,192,936 (GRCm39) probably benign Het
Lcmt1 G A 7: 123,002,094 (GRCm39) D120N probably damaging Het
Myom3 A G 4: 135,492,237 (GRCm39) D127G possibly damaging Het
Or12e1 A G 2: 87,022,652 (GRCm39) Y207C probably damaging Het
Or1j4 T C 2: 36,740,202 (GRCm39) L48P probably damaging Het
Or5w13 C T 2: 87,524,152 (GRCm39) V25I probably benign Het
Phyhd1 A G 2: 30,171,040 (GRCm39) H241R probably damaging Het
Ppp2r5d A T 17: 46,997,330 (GRCm39) N287K probably damaging Het
Ralgds A G 2: 28,435,218 (GRCm39) H458R probably damaging Het
Scn3a C A 2: 65,314,755 (GRCm39) R1102L probably null Het
Sdhc T C 1: 170,963,626 (GRCm39) Y80C probably damaging Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,612,239 (GRCm39) probably benign Het
Tgfbr3 A T 5: 107,325,716 (GRCm39) H115Q probably benign Het
Triobp T C 15: 78,858,098 (GRCm39) L1233P possibly damaging Het
Trpc6 A C 9: 8,634,123 (GRCm39) T401P probably benign Het
Ttc5 T A 14: 51,003,415 (GRCm39) Q423L probably benign Het
Other mutations in Gtf2h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gtf2h2 APN 13 100,617,506 (GRCm39) unclassified probably benign
IGL00780:Gtf2h2 APN 13 100,615,729 (GRCm39) missense probably benign 0.01
IGL01475:Gtf2h2 APN 13 100,617,541 (GRCm39) missense probably damaging 1.00
IGL02298:Gtf2h2 APN 13 100,617,547 (GRCm39) missense probably damaging 1.00
IGL02754:Gtf2h2 APN 13 100,617,747 (GRCm39) missense probably damaging 1.00
R0602:Gtf2h2 UTSW 13 100,605,533 (GRCm39) missense probably benign 0.03
R0621:Gtf2h2 UTSW 13 100,625,433 (GRCm39) missense probably damaging 1.00
R4709:Gtf2h2 UTSW 13 100,605,523 (GRCm39) nonsense probably null
R4810:Gtf2h2 UTSW 13 100,617,510 (GRCm39) critical splice donor site probably null
R5262:Gtf2h2 UTSW 13 100,618,356 (GRCm39) unclassified probably benign
R5548:Gtf2h2 UTSW 13 100,617,544 (GRCm39) missense possibly damaging 0.92
R5741:Gtf2h2 UTSW 13 100,617,066 (GRCm39) missense probably benign 0.00
R6802:Gtf2h2 UTSW 13 100,617,051 (GRCm39) missense probably benign 0.39
R7256:Gtf2h2 UTSW 13 100,615,709 (GRCm39) missense probably benign 0.05
R8355:Gtf2h2 UTSW 13 100,605,503 (GRCm39) missense possibly damaging 0.89
R9139:Gtf2h2 UTSW 13 100,617,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACATGATGTGCCAACAACTC -3'
(R):5'- AGTGCTCATCATCTTCAGCAGCC -3'

Sequencing Primer
(F):5'- GTGCCAACAACTCCTTGTAATGG -3'
(R):5'- AGCACTAGCTTTCAGAACAGTA -3'
Posted On 2013-07-30