Incidental Mutation 'R8064:Csl'
ID619911
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R8064 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99758545 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 219 (N219K)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056085
AA Change: N219K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: N219K

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,924 I238T probably damaging Het
Adam3 A T 8: 24,681,550 V755D probably benign Het
Adgrb3 A T 1: 25,420,556 probably null Het
Anapc2 T C 2: 25,276,406 V395A probably benign Het
Apol11b A G 15: 77,635,217 V221A not run Het
Arhgef28 T A 13: 97,978,494 Y616F probably benign Het
Brdt C A 5: 107,377,996 S905* probably null Het
Ccdc54 T A 16: 50,589,964 H313L probably benign Het
Chuk A G 19: 44,082,676 L530P probably damaging Het
Cyp2j5 A G 4: 96,658,711 S189P probably damaging Het
Cyp4a14 A T 4: 115,494,958 C86S probably benign Het
Dgkg TCTCCT TCT 16: 22,580,594 probably null Het
F11 C T 8: 45,245,773 G445S probably benign Het
Fer T A 17: 63,907,423 I117N probably benign Het
Gpat3 A T 5: 100,891,656 I290F probably benign Het
H2-M10.2 C T 17: 36,284,550 V283M probably damaging Het
Hpse G A 5: 100,688,900 P408S probably benign Het
Hyou1 T A 9: 44,385,585 N515K possibly damaging Het
Idh1 A G 1: 65,166,179 L209P probably damaging Het
Igkv16-104 A T 6: 68,425,891 Y56F possibly damaging Het
Ins2 A G 7: 142,678,816 L77P probably benign Het
Kcnn2 A T 18: 45,559,359 M1L probably benign Het
Kdm3b A T 18: 34,813,407 probably null Het
Lysmd4 T C 7: 67,223,650 F11S probably damaging Het
Macf1 T A 4: 123,459,374 D3625V possibly damaging Het
Mlkl T A 8: 111,312,068 E459V probably benign Het
Nsd3 A T 8: 25,700,670 K210* probably null Het
Olfr1122 C T 2: 87,388,509 T268I probably benign Het
Olfr1491 T C 19: 13,705,022 F65S probably damaging Het
Olfr658 T A 7: 104,645,354 Q6L probably benign Het
Pcsk5 T C 19: 17,714,861 N153S probably damaging Het
Rac3 T A 11: 120,723,575 V182E probably benign Het
Ripk3 T G 14: 55,787,926 E60D possibly damaging Het
Sacs T A 14: 61,192,175 I561N possibly damaging Het
Smad7 A G 18: 75,394,082 Y333C probably damaging Het
Snhg11 T G 2: 158,376,201 M1R probably null Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spon1 T A 7: 114,036,621 I690N probably damaging Het
Taok1 G A 11: 77,549,304 R626* probably null Het
Tecta C T 9: 42,394,955 G59D possibly damaging Het
Tmem8b T C 4: 43,690,139 F399S probably damaging Het
Trank1 C T 9: 111,352,076 Q389* probably null Het
Vmn1r33 G T 6: 66,611,927 S214R probably benign Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zfp335 G A 2: 164,907,700 T259I probably damaging Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2284:Csl UTSW 10 99758459 missense possibly damaging 0.84
R2882:Csl UTSW 10 99758925 missense probably damaging 1.00
R4128:Csl UTSW 10 99758600 missense probably benign 0.02
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R5700:Csl UTSW 10 99759015 missense probably damaging 0.97
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
R8696:Csl UTSW 10 99758964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGGCTGCTGCAAAGG -3'
(R):5'- AATTGCACCCCATGTCTCAGC -3'

Sequencing Primer
(F):5'- CTGCTGCAAAGGACAGGTAAG -3'
(R):5'- ATGTCTCAGCTCAGTGCAG -3'
Posted On2020-01-23