Incidental Mutation 'R8064:Chuk'
ID619927
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8064 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44082676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 530 (L530P)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: L530P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: L530P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119591
AA Change: L530P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: L530P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,924 I238T probably damaging Het
Adam3 A T 8: 24,681,550 V755D probably benign Het
Adgrb3 A T 1: 25,420,556 probably null Het
Anapc2 T C 2: 25,276,406 V395A probably benign Het
Apol11b A G 15: 77,635,217 V221A not run Het
Arhgef28 T A 13: 97,978,494 Y616F probably benign Het
Brdt C A 5: 107,377,996 S905* probably null Het
Ccdc54 T A 16: 50,589,964 H313L probably benign Het
Csl A T 10: 99,758,545 N219K probably damaging Het
Cyp2j5 A G 4: 96,658,711 S189P probably damaging Het
Cyp4a14 A T 4: 115,494,958 C86S probably benign Het
Dgkg TCTCCT TCT 16: 22,580,594 probably null Het
F11 C T 8: 45,245,773 G445S probably benign Het
Fer T A 17: 63,907,423 I117N probably benign Het
Gpat3 A T 5: 100,891,656 I290F probably benign Het
H2-M10.2 C T 17: 36,284,550 V283M probably damaging Het
Hpse G A 5: 100,688,900 P408S probably benign Het
Hyou1 T A 9: 44,385,585 N515K possibly damaging Het
Idh1 A G 1: 65,166,179 L209P probably damaging Het
Igkv16-104 A T 6: 68,425,891 Y56F possibly damaging Het
Ins2 A G 7: 142,678,816 L77P probably benign Het
Kcnn2 A T 18: 45,559,359 M1L probably benign Het
Kdm3b A T 18: 34,813,407 probably null Het
Lysmd4 T C 7: 67,223,650 F11S probably damaging Het
Macf1 T A 4: 123,459,374 D3625V possibly damaging Het
Mlkl T A 8: 111,312,068 E459V probably benign Het
Nsd3 A T 8: 25,700,670 K210* probably null Het
Olfr1122 C T 2: 87,388,509 T268I probably benign Het
Olfr1491 T C 19: 13,705,022 F65S probably damaging Het
Olfr658 T A 7: 104,645,354 Q6L probably benign Het
Pcsk5 T C 19: 17,714,861 N153S probably damaging Het
Rac3 T A 11: 120,723,575 V182E probably benign Het
Ripk3 T G 14: 55,787,926 E60D possibly damaging Het
Sacs T A 14: 61,192,175 I561N possibly damaging Het
Smad7 A G 18: 75,394,082 Y333C probably damaging Het
Snhg11 T G 2: 158,376,201 M1R probably null Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spon1 T A 7: 114,036,621 I690N probably damaging Het
Taok1 G A 11: 77,549,304 R626* probably null Het
Tecta C T 9: 42,394,955 G59D possibly damaging Het
Tmem8b T C 4: 43,690,139 F399S probably damaging Het
Trank1 C T 9: 111,352,076 Q389* probably null Het
Vmn1r33 G T 6: 66,611,927 S214R probably benign Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zfp335 G A 2: 164,907,700 T259I probably damaging Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACTCCCTATGACTAAGAAAGAGCTTC -3'
(R):5'- CTTTAACCAGTCTAGTGTGCTTTAC -3'

Sequencing Primer
(F):5'- AACCTGAGTTCAATTCCTGGG -3'
(R):5'- TACAGGTTCAAGACTAGTCTAGCC -3'
Posted On2020-01-23