Incidental Mutation 'R8065:Gpr87'
ID 619934
Institutional Source Beutler Lab
Gene Symbol Gpr87
Ensembl Gene ENSMUSG00000051431
Gene Name G protein-coupled receptor 87
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 59178923-59195104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59179887 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 66 (I66F)
Ref Sequence ENSEMBL: ENSMUSP00000143683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000056898] [ENSMUST00000164225] [ENSMUST00000199659] [ENSMUST00000200095]
AlphaFold Q99MT7
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000056898
AA Change: I67F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059272
Gene: ENSMUSG00000051431
AA Change: I67F

DomainStartEndE-ValueType
Pfam:7tm_1 60 315 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200095
AA Change: I66F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143683
Gene: ENSMUSG00000051431
AA Change: I66F

DomainStartEndE-ValueType
Pfam:7tm_1 59 314 3.5e-37 PFAM
Meta Mutation Damage Score 0.3965 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor and is located in a cluster of G protein-couple receptor genes on chromosome 3. The encoded protein has been shown to be overexpressed in lung squamous cell carcinoma (PMID:18057535) and regulated by p53 (PMID:19602589). [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased mean vertebral and femoral bone measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Gpr87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Gpr87 APN 3 59179790 missense probably damaging 1.00
IGL02309:Gpr87 APN 3 59179554 missense possibly damaging 0.74
IGL02614:Gpr87 APN 3 59179317 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0113:Gpr87 UTSW 3 59179511 missense possibly damaging 0.86
R1801:Gpr87 UTSW 3 59179392 missense possibly damaging 0.92
R2213:Gpr87 UTSW 3 59179044 missense probably damaging 0.99
R2698:Gpr87 UTSW 3 59179166 missense probably damaging 1.00
R5459:Gpr87 UTSW 3 59179727 missense possibly damaging 0.89
R5490:Gpr87 UTSW 3 59179326 missense probably damaging 0.99
R5963:Gpr87 UTSW 3 59179269 nonsense probably null
R6189:Gpr87 UTSW 3 59179229 missense probably damaging 1.00
R6251:Gpr87 UTSW 3 59179107 missense probably damaging 0.99
R7863:Gpr87 UTSW 3 59179896 missense probably damaging 1.00
R8008:Gpr87 UTSW 3 59180045 missense probably benign
R8067:Gpr87 UTSW 3 59179887 missense probably damaging 1.00
R8096:Gpr87 UTSW 3 59179808 missense possibly damaging 0.70
R8141:Gpr87 UTSW 3 59179599 missense probably damaging 1.00
R8326:Gpr87 UTSW 3 59194974 start gained probably benign
R9326:Gpr87 UTSW 3 59179188 missense probably damaging 1.00
R9485:Gpr87 UTSW 3 59179584 missense possibly damaging 0.85
Z1177:Gpr87 UTSW 3 59180070 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACCAAAGGGCTTTACCAC -3'
(R):5'- TGGCTGTCCCTAATGTGAATG -3'

Sequencing Primer
(F):5'- AAGGGCTTTACCACCTTTAGATACCG -3'
(R):5'- GCTGTCCCTAATGTGAATGTTTCTAC -3'
Posted On 2020-01-23