Incidental Mutation 'R8065:Igkv11-125'
ID 619945
Institutional Source Beutler Lab
Gene Symbol Igkv11-125
Ensembl Gene ENSMUSG00000095737
Gene Name immunoglobulin kappa variable 11-125
Synonyms ENSMUSG00000050218
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 67890557-67891036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67890814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 44 (T44N)
Ref Sequence ENSEMBL: ENSMUSP00000142805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103311] [ENSMUST00000197406]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000103311
AA Change: T43N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100112
Gene: ENSMUSG00000095737
AA Change: T43N

DomainStartEndE-ValueType
IGv 39 111 2.26e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197406
AA Change: T44N

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142805
Gene: ENSMUSG00000095737
AA Change: T44N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 40 112 9.2e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Igkv11-125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Igkv11-125 APN 6 67,890,991 (GRCm39) missense probably damaging 0.99
R0532:Igkv11-125 UTSW 6 67,890,603 (GRCm39) nonsense probably null
R3108:Igkv11-125 UTSW 6 67,890,855 (GRCm39) missense possibly damaging 0.56
R3109:Igkv11-125 UTSW 6 67,890,855 (GRCm39) missense possibly damaging 0.56
R8067:Igkv11-125 UTSW 6 67,890,814 (GRCm39) missense probably benign 0.26
R9640:Igkv11-125 UTSW 6 67,890,783 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCAGAATGAACACGAGGGCC -3'
(R):5'- AGCCAAGCCTCTCACTTCTG -3'

Sequencing Primer
(F):5'- CCCTGCTGAGTTCCTTGGG -3'
(R):5'- TGCTGTAGACAGAAATAAGTTGCC -3'
Posted On 2020-01-23