Incidental Mutation 'R8065:Olfr65'
ID 619946
Institutional Source Beutler Lab
Gene Symbol Olfr65
Ensembl Gene ENSMUSG00000110259
Gene Name olfactory receptor 65
Synonyms 5'[b]3, GA_x6K02T2PBJ9-6634906-6633983, MOR1-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103903487-103908650 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 103906403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
AlphaFold A0A1B0GSF4
Predicted Effect probably benign
Transcript: ENSMUST00000106864
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209528
Predicted Effect probably benign
Transcript: ENSMUST00000214300
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Olfr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr65 APN 7 103906462 missense probably benign
IGL02830:Olfr65 APN 7 103906444 missense probably benign 0.32
IGL03238:Olfr65 APN 7 103906510 missense probably benign
R0674:Olfr65 UTSW 7 103907255 missense probably benign 0.01
R1711:Olfr65 UTSW 7 103906699 missense probably damaging 1.00
R2018:Olfr65 UTSW 7 103907042 missense possibly damaging 0.88
R2363:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R2968:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R2970:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R3746:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R4928:Olfr65 UTSW 7 103906672 missense probably damaging 1.00
R5092:Olfr65 UTSW 7 103907199 nonsense probably null
R5635:Olfr65 UTSW 7 103906638 missense probably benign 0.05
R5881:Olfr65 UTSW 7 103906676 missense probably damaging 0.98
R5963:Olfr65 UTSW 7 103906961 missense probably benign 0.02
R5969:Olfr65 UTSW 7 103906910 missense probably damaging 0.98
R6859:Olfr65 UTSW 7 103906701 nonsense probably null
R7857:Olfr65 UTSW 7 103906610 missense
R8067:Olfr65 UTSW 7 103906403 start gained probably benign
R8381:Olfr65 UTSW 7 103906939 missense
R8501:Olfr65 UTSW 7 103906611 missense
R8737:Olfr65 UTSW 7 103906706 missense
R8796:Olfr65 UTSW 7 103906994 missense
R9007:Olfr65 UTSW 7 103906958 missense
R9455:Olfr65 UTSW 7 103906993 missense
R9591:Olfr65 UTSW 7 103907263 missense
X0065:Olfr65 UTSW 7 103907216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGTGAGCCCTGGAAG -3'
(R):5'- TCCGTAGCTGCCAACATAC -3'

Sequencing Primer
(F):5'- ATGTGAGCCCTGGAAGTATATG -3'
(R):5'- CTCATGGAGGTTATGGTCATCC -3'
Posted On 2020-01-23