Incidental Mutation 'R8065:Or51b6'
ID 619946
Institutional Source Beutler Lab
Gene Symbol Or51b6
Ensembl Gene ENSMUSG00000110259
Gene Name olfactory receptor family 51 subfamily B member 6
Synonyms MOR1-2, Olfr65, 5'[b]3, GA_x6K02T2PBJ9-6634906-6633983
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103555549-103556654 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 103555610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
AlphaFold A0A1B0GSF4
Predicted Effect probably benign
Transcript: ENSMUST00000106864
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209528
Predicted Effect probably benign
Transcript: ENSMUST00000214300
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Or51b6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Or51b6 APN 7 103,555,669 (GRCm39) missense probably benign
IGL02830:Or51b6 APN 7 103,555,651 (GRCm39) missense probably benign 0.32
IGL03238:Or51b6 APN 7 103,555,717 (GRCm39) missense probably benign
R0674:Or51b6 UTSW 7 103,556,462 (GRCm39) missense probably benign 0.01
R1711:Or51b6 UTSW 7 103,555,906 (GRCm39) missense probably damaging 1.00
R2018:Or51b6 UTSW 7 103,556,249 (GRCm39) missense possibly damaging 0.88
R2363:Or51b6 UTSW 7 103,556,267 (GRCm39) missense probably benign 0.19
R2968:Or51b6 UTSW 7 103,556,519 (GRCm39) missense probably benign 0.01
R2970:Or51b6 UTSW 7 103,556,519 (GRCm39) missense probably benign 0.01
R3746:Or51b6 UTSW 7 103,556,267 (GRCm39) missense probably benign 0.19
R4928:Or51b6 UTSW 7 103,555,879 (GRCm39) missense probably damaging 1.00
R5092:Or51b6 UTSW 7 103,556,406 (GRCm39) nonsense probably null
R5635:Or51b6 UTSW 7 103,555,845 (GRCm39) missense probably benign 0.05
R5881:Or51b6 UTSW 7 103,555,883 (GRCm39) missense probably damaging 0.98
R5963:Or51b6 UTSW 7 103,556,168 (GRCm39) missense probably benign 0.02
R5969:Or51b6 UTSW 7 103,556,117 (GRCm39) missense probably damaging 0.98
R6859:Or51b6 UTSW 7 103,555,908 (GRCm39) nonsense probably null
R7857:Or51b6 UTSW 7 103,555,817 (GRCm39) missense
R8067:Or51b6 UTSW 7 103,555,610 (GRCm39) start gained probably benign
R8381:Or51b6 UTSW 7 103,556,146 (GRCm39) missense
R8501:Or51b6 UTSW 7 103,555,818 (GRCm39) missense
R8737:Or51b6 UTSW 7 103,555,913 (GRCm39) missense
R8796:Or51b6 UTSW 7 103,556,201 (GRCm39) missense
R9007:Or51b6 UTSW 7 103,556,165 (GRCm39) missense
R9455:Or51b6 UTSW 7 103,556,200 (GRCm39) missense
R9591:Or51b6 UTSW 7 103,556,470 (GRCm39) missense
X0065:Or51b6 UTSW 7 103,556,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGTGAGCCCTGGAAG -3'
(R):5'- TCCGTAGCTGCCAACATAC -3'

Sequencing Primer
(F):5'- ATGTGAGCCCTGGAAGTATATG -3'
(R):5'- CTCATGGAGGTTATGGTCATCC -3'
Posted On 2020-01-23