Incidental Mutation 'R8065:Zfpm1'
ID 619948
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Name zinc finger protein, multitype 1
Synonyms Fog1, Friend of GATA-1
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.797) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123008880-123063990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123062323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 461 (S461P)
Ref Sequence ENSEMBL: ENSMUSP00000058037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
AlphaFold O35615
PDB Structure Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054052
AA Change: S461P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: S461P

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 123,058,859 (GRCm39) missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 123,061,227 (GRCm39) missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 123,061,872 (GRCm39) missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 123,063,613 (GRCm39) intron probably benign
R0729:Zfpm1 UTSW 8 123,063,398 (GRCm39) missense probably benign 0.20
R0883:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 123,034,285 (GRCm39) missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 123,061,663 (GRCm39) splice site probably null
R2060:Zfpm1 UTSW 8 123,063,331 (GRCm39) missense probably benign 0.37
R3735:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R3736:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R4528:Zfpm1 UTSW 8 123,062,381 (GRCm39) missense probably benign 0.06
R4735:Zfpm1 UTSW 8 123,062,219 (GRCm39) missense probably benign 0.24
R4924:Zfpm1 UTSW 8 123,061,347 (GRCm39) missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 123,062,269 (GRCm39) missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 123,062,812 (GRCm39) missense probably benign 0.00
R5470:Zfpm1 UTSW 8 123,060,532 (GRCm39) missense probably damaging 0.99
R6358:Zfpm1 UTSW 8 123,063,850 (GRCm39) intron probably benign
R6768:Zfpm1 UTSW 8 123,061,195 (GRCm39) missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 123,058,904 (GRCm39) missense probably damaging 1.00
R7422:Zfpm1 UTSW 8 123,063,698 (GRCm39) missense unknown
R7782:Zfpm1 UTSW 8 123,063,689 (GRCm39) missense unknown
R8067:Zfpm1 UTSW 8 123,062,323 (GRCm39) missense probably benign 0.00
R8192:Zfpm1 UTSW 8 123,058,833 (GRCm39) missense probably damaging 1.00
R8835:Zfpm1 UTSW 8 123,063,772 (GRCm39) missense unknown
R9308:Zfpm1 UTSW 8 123,034,231 (GRCm39) missense probably benign 0.13
R9342:Zfpm1 UTSW 8 123,061,308 (GRCm39) missense probably benign 0.29
R9698:Zfpm1 UTSW 8 123,063,868 (GRCm39) missense unknown
R9763:Zfpm1 UTSW 8 123,062,531 (GRCm39) missense probably damaging 1.00
Z1192:Zfpm1 UTSW 8 123,060,612 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGCAGCCCTGTGTTC -3'
(R):5'- TTGTGGCAGAAAGAGTGTCC -3'

Sequencing Primer
(F):5'- TCTTGTAGACAGCCTGGCAG -3'
(R):5'- AAAGAGTGTCCCGGCCATTG -3'
Posted On 2020-01-23