Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Zfpm1'

619948

Institutional Source

Beutler Lab

Gene Symbol

Zfpm1

Ensembl Gene

ENSMUSG00000049577

Gene Name

zinc finger protein, multitype 1

Synonyms

Fog1, Friend of GATA-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.761) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122282141-122337251 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122335584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 461 (S461P)

Ref Sequence

ENSEMBL: ENSMUSP00000058037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]

AlphaFold

O35615

PDB Structure

Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000054052
AA Change: S461P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: S461P

Domain	Start	End	E-Value	Type
low complexity region	32	72	N/A	INTRINSIC
low complexity region	86	94	N/A	INTRINSIC
ZnF_C2H2	255	275	3.13e1	SMART
ZnF_C2H2	303	327	1.69e-3	SMART
ZnF_C2H2	333	355	1.53e-1	SMART
ZnF_C2H2	361	384	9.46e0	SMART
low complexity region	508	525	N/A	INTRINSIC
low complexity region	570	578	N/A	INTRINSIC
ZnF_C2H2	590	610	1.41e2	SMART
low complexity region	626	643	N/A	INTRINSIC
low complexity region	644	663	N/A	INTRINSIC
ZnF_C2H2	696	723	1.78e2	SMART
low complexity region	725	755	N/A	INTRINSIC
low complexity region	761	779	N/A	INTRINSIC
low complexity region	785	806	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ZnF_C2H2	836	856	7.77e1	SMART
ZnF_C2H2	868	891	1.96e1	SMART
low complexity region	948	961	N/A	INTRINSIC
ZnF_C2H2	963	989	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het

Other mutations in Zfpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02540:Zfpm1	APN	8	122332120	missense	possibly damaging	0.65
R0006:Zfpm1	UTSW	8	122334488	missense	probably damaging	1.00
R0508:Zfpm1	UTSW	8	122335133	missense	probably damaging	1.00
R0631:Zfpm1	UTSW	8	122336874	intron	probably benign
R0729:Zfpm1	UTSW	8	122336659	missense	probably benign	0.20
R0883:Zfpm1	UTSW	8	122335846	missense	probably damaging	0.99
R1469:Zfpm1	UTSW	8	122335846	missense	probably damaging	0.99
R1469:Zfpm1	UTSW	8	122335846	missense	probably damaging	0.99
R1509:Zfpm1	UTSW	8	122307546	missense	possibly damaging	0.63
R1938:Zfpm1	UTSW	8	122334924	splice site	probably null
R2060:Zfpm1	UTSW	8	122336592	missense	probably benign	0.37
R3735:Zfpm1	UTSW	8	122323736	missense	possibly damaging	0.83
R3736:Zfpm1	UTSW	8	122323736	missense	possibly damaging	0.83
R4528:Zfpm1	UTSW	8	122335642	missense	probably benign	0.06
R4735:Zfpm1	UTSW	8	122335480	missense	probably benign	0.24
R4924:Zfpm1	UTSW	8	122334608	missense	possibly damaging	0.95
R5347:Zfpm1	UTSW	8	122335530	missense	possibly damaging	0.94
R5375:Zfpm1	UTSW	8	122336073	missense	probably benign	0.00
R5470:Zfpm1	UTSW	8	122333793	missense	probably damaging	0.99
R6358:Zfpm1	UTSW	8	122337111	intron	probably benign
R6768:Zfpm1	UTSW	8	122334456	missense	probably damaging	1.00
R6966:Zfpm1	UTSW	8	122332165	missense	probably damaging	1.00
R7422:Zfpm1	UTSW	8	122336959	missense	unknown
R7782:Zfpm1	UTSW	8	122336950	missense	unknown
R8067:Zfpm1	UTSW	8	122335584	missense	probably benign	0.00
R8192:Zfpm1	UTSW	8	122332094	missense	probably damaging	1.00
R8835:Zfpm1	UTSW	8	122337033	missense	unknown
R9308:Zfpm1	UTSW	8	122307492	missense	probably benign	0.13
R9342:Zfpm1	UTSW	8	122334569	missense	probably benign	0.29
R9698:Zfpm1	UTSW	8	122337129	missense	unknown
R9763:Zfpm1	UTSW	8	122335792	missense	probably damaging	1.00
Z1192:Zfpm1	UTSW	8	122333873	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACATGCAGCCCTGTGTTC -3'
(R):5'- TTGTGGCAGAAAGAGTGTCC -3'

Sequencing Primer
(F):5'- TCTTGTAGACAGCCTGGCAG -3'
(R):5'- AAAGAGTGTCCCGGCCATTG -3'

Posted On

2020-01-23