Incidental Mutation 'R8065:Ldlr'
ID 619949
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21634872-21661215 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21649241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 339 (C339S)
Ref Sequence ENSEMBL: ENSMUSP00000034713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably damaging
Transcript: ENSMUST00000034713
AA Change: C339S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: C339S

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213114
AA Change: C339S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21,646,657 (GRCm39) critical splice donor site probably null
IGL01975:Ldlr APN 9 21,644,993 (GRCm39) missense probably benign 0.05
IGL02043:Ldlr APN 9 21,644,795 (GRCm39) missense probably benign 0.03
IGL02524:Ldlr APN 9 21,644,977 (GRCm39) missense probably damaging 1.00
IGL03049:Ldlr APN 9 21,657,115 (GRCm39) missense probably benign 0.00
IGL03113:Ldlr APN 9 21,651,124 (GRCm39) missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21,649,295 (GRCm39) splice site probably benign
R0586:Ldlr UTSW 9 21,651,040 (GRCm39) missense probably benign 0.00
R1398:Ldlr UTSW 9 21,650,838 (GRCm39) missense probably benign 0.01
R1587:Ldlr UTSW 9 21,649,209 (GRCm39) missense probably damaging 0.99
R2198:Ldlr UTSW 9 21,643,698 (GRCm39) missense probably damaging 1.00
R3730:Ldlr UTSW 9 21,643,097 (GRCm39) missense probably benign 0.09
R4422:Ldlr UTSW 9 21,649,248 (GRCm39) missense probably damaging 1.00
R5044:Ldlr UTSW 9 21,646,538 (GRCm39) missense probably benign 0.00
R5046:Ldlr UTSW 9 21,657,203 (GRCm39) critical splice donor site probably null
R6186:Ldlr UTSW 9 21,635,055 (GRCm39) start gained probably benign
R6195:Ldlr UTSW 9 21,643,077 (GRCm39) nonsense probably null
R6523:Ldlr UTSW 9 21,648,549 (GRCm39) missense probably damaging 1.00
R6682:Ldlr UTSW 9 21,643,671 (GRCm39) missense probably benign
R7256:Ldlr UTSW 9 21,657,040 (GRCm39) missense probably benign 0.01
R7384:Ldlr UTSW 9 21,651,090 (GRCm39) missense probably benign 0.07
R7823:Ldlr UTSW 9 21,653,602 (GRCm39) critical splice donor site probably null
R8223:Ldlr UTSW 9 21,658,546 (GRCm39) missense probably damaging 1.00
R8732:Ldlr UTSW 9 21,650,985 (GRCm39) missense probably benign 0.00
R8931:Ldlr UTSW 9 21,643,108 (GRCm39) missense probably damaging 0.99
R8954:Ldlr UTSW 9 21,650,828 (GRCm39) missense possibly damaging 0.87
R9315:Ldlr UTSW 9 21,644,782 (GRCm39) splice site probably benign
R9489:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9517:Ldlr UTSW 9 21,655,240 (GRCm39) missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9709:Ldlr UTSW 9 21,657,135 (GRCm39) missense probably benign 0.00
X0024:Ldlr UTSW 9 21,651,114 (GRCm39) missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21,651,126 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGTGTTTTGCGAAGGC -3'
(R):5'- ATGAGGATCCCCAAAGGCAG -3'

Sequencing Primer
(F):5'- CAGTGCAGTAGCGTAGTGTTCC -3'
(R):5'- TTGCTCTTAACAGTCAGGCCAGG -3'
Posted On 2020-01-23