Incidental Mutation 'R8065:Ldlr'
ID 619949
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21723483-21749919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21737945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 339 (C339S)
Ref Sequence ENSEMBL: ENSMUSP00000034713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably damaging
Transcript: ENSMUST00000034713
AA Change: C339S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: C339S

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213114
AA Change: C339S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21735361 critical splice donor site probably null
IGL01975:Ldlr APN 9 21733697 missense probably benign 0.05
IGL02043:Ldlr APN 9 21733499 missense probably benign 0.03
IGL02524:Ldlr APN 9 21733681 missense probably damaging 1.00
IGL03049:Ldlr APN 9 21745819 missense probably benign 0.00
IGL03113:Ldlr APN 9 21739828 missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21737999 splice site probably benign
R0586:Ldlr UTSW 9 21739744 missense probably benign 0.00
R1398:Ldlr UTSW 9 21739542 missense probably benign 0.01
R1587:Ldlr UTSW 9 21737913 missense probably damaging 0.99
R2198:Ldlr UTSW 9 21732402 missense probably damaging 1.00
R3730:Ldlr UTSW 9 21731801 missense probably benign 0.09
R4422:Ldlr UTSW 9 21737952 missense probably damaging 1.00
R5044:Ldlr UTSW 9 21735242 missense probably benign 0.00
R5046:Ldlr UTSW 9 21745907 critical splice donor site probably null
R6186:Ldlr UTSW 9 21723759 start gained probably benign
R6195:Ldlr UTSW 9 21731781 nonsense probably null
R6523:Ldlr UTSW 9 21737253 missense probably damaging 1.00
R6682:Ldlr UTSW 9 21732375 missense probably benign
R7256:Ldlr UTSW 9 21745744 missense probably benign 0.01
R7384:Ldlr UTSW 9 21739794 missense probably benign 0.07
R7823:Ldlr UTSW 9 21742306 critical splice donor site probably null
R8223:Ldlr UTSW 9 21747250 missense probably damaging 1.00
R8732:Ldlr UTSW 9 21739689 missense probably benign 0.00
R8931:Ldlr UTSW 9 21731812 missense probably damaging 0.99
R8954:Ldlr UTSW 9 21739532 missense possibly damaging 0.87
R9315:Ldlr UTSW 9 21733486 splice site probably benign
R9489:Ldlr UTSW 9 21735330 missense probably damaging 1.00
R9517:Ldlr UTSW 9 21743944 missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21735330 missense probably damaging 1.00
R9709:Ldlr UTSW 9 21745839 missense probably benign 0.00
X0024:Ldlr UTSW 9 21739818 missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21739830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGTGTTTTGCGAAGGC -3'
(R):5'- ATGAGGATCCCCAAAGGCAG -3'

Sequencing Primer
(F):5'- CAGTGCAGTAGCGTAGTGTTCC -3'
(R):5'- TTGCTCTTAACAGTCAGGCCAGG -3'
Posted On 2020-01-23