Incidental Mutation 'R8065:Dlat'
ID 619950
Institutional Source Beutler Lab
Gene Symbol Dlat
Ensembl Gene ENSMUSG00000000168
Gene Name dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
Synonyms PDC-E2, 6332404G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 50634633-50659780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50657849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 218 (M218K)
Ref Sequence ENSEMBL: ENSMUSP00000034567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000034567] [ENSMUST00000117646]
AlphaFold Q8BMF4
Predicted Effect probably benign
Transcript: ENSMUST00000034566
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000034567
AA Change: M218K

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034567
Gene: ENSMUSG00000000168
AA Change: M218K

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 91 164 4.3e-17 PFAM
low complexity region 183 210 N/A INTRINSIC
Pfam:Biotin_lipoyl 218 292 1.2e-17 PFAM
low complexity region 315 344 N/A INTRINSIC
Pfam:E3_binding 350 385 2.6e-18 PFAM
Pfam:2-oxoacid_dh 412 642 9.9e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117646
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Dlat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Dlat APN 9 50645032 splice site probably benign
IGL00870:Dlat APN 9 50650869 missense probably damaging 1.00
R0440:Dlat UTSW 9 50645119 splice site probably null
R0530:Dlat UTSW 9 50637569 missense probably damaging 1.00
R0745:Dlat UTSW 9 50653708 missense probably damaging 0.99
R1870:Dlat UTSW 9 50637574 missense probably damaging 0.99
R3237:Dlat UTSW 9 50638031 missense possibly damaging 0.81
R3696:Dlat UTSW 9 50650876 missense possibly damaging 0.63
R3715:Dlat UTSW 9 50638054 missense probably damaging 1.00
R3924:Dlat UTSW 9 50658190 missense possibly damaging 0.55
R4016:Dlat UTSW 9 50649631 critical splice donor site probably null
R4197:Dlat UTSW 9 50636526 missense probably damaging 1.00
R4713:Dlat UTSW 9 50644481 missense probably benign
R4789:Dlat UTSW 9 50659370 missense probably benign
R5893:Dlat UTSW 9 50644139 splice site probably benign
R6138:Dlat UTSW 9 50645117 splice site probably null
R6778:Dlat UTSW 9 50650857 missense probably damaging 1.00
R7010:Dlat UTSW 9 50657974 missense probably damaging 1.00
R8677:Dlat UTSW 9 50658707 missense probably damaging 0.99
R8724:Dlat UTSW 9 50649667 missense probably damaging 1.00
R8725:Dlat UTSW 9 50649667 missense probably damaging 1.00
R8742:Dlat UTSW 9 50649667 missense probably damaging 1.00
R8745:Dlat UTSW 9 50649667 missense probably damaging 1.00
R8753:Dlat UTSW 9 50649667 missense probably damaging 1.00
R8754:Dlat UTSW 9 50649667 missense probably damaging 1.00
R9111:Dlat UTSW 9 50659606 unclassified probably benign
R9777:Dlat UTSW 9 50650908 missense probably damaging 0.99
U15987:Dlat UTSW 9 50645117 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCCAGGCTCACACACTTAG -3'
(R):5'- AGACATGTGAGGACTCGCTG -3'

Sequencing Primer
(F):5'- GGCTCACACACTTAGAAACAACAAG -3'
(R):5'- CTCGCTGGGAGGTTAGGG -3'
Posted On 2020-01-23