Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Hmmr'

619953

Institutional Source

Beutler Lab

Gene Symbol

Hmmr

Ensembl Gene

ENSMUSG00000020330

Gene Name

hyaluronan mediated motility receptor (RHAMM)

Synonyms

CD168, Rhamm

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40701395-40733422 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40721672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 206 (S206F)

Ref Sequence

ENSEMBL: ENSMUSP00000020579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020579]

AlphaFold

Q00547

Predicted Effect

probably damaging
Transcript: ENSMUST00000020579
AA Change: S206F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: S206F

Domain	Start	End	E-Value	Type
Pfam:HMMR_N	15	339	1.2e-136	PFAM
low complexity region	375	385	N/A	INTRINSIC
low complexity region	430	442	N/A	INTRINSIC
Blast:MA	452	578	7e-6	BLAST
Pfam:HMMR_C	636	789	4.3e-71	PFAM

Meta Mutation Damage Score

0.0706

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Hmmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01795:Hmmr	APN	11	40721734	missense	probably benign	0.25
IGL02096:Hmmr	APN	11	40707429	missense	probably benign	0.02
IGL02224:Hmmr	APN	11	40710004	missense	unknown
IGL02527:Hmmr	APN	11	40708105	missense	probably damaging	1.00
IGL02870:Hmmr	APN	11	40714075	missense	possibly damaging	0.63
IGL03175:Hmmr	APN	11	40714809	missense	probably benign	0.02
IGL03327:Hmmr	APN	11	40715415	missense	probably damaging	1.00
R0126:Hmmr	UTSW	11	40705954	missense	probably damaging	1.00
R0211:Hmmr	UTSW	11	40714808	missense	probably damaging	0.96
R0533:Hmmr	UTSW	11	40709989	missense	unknown
R0610:Hmmr	UTSW	11	40715902	missense	probably damaging	1.00
R0747:Hmmr	UTSW	11	40721745	splice site	probably benign
R1909:Hmmr	UTSW	11	40708098	missense	probably damaging	1.00
R2013:Hmmr	UTSW	11	40728432	missense	possibly damaging	0.85
R4446:Hmmr	UTSW	11	40715321	missense	probably damaging	1.00
R4897:Hmmr	UTSW	11	40728434	missense	probably benign	0.00
R4937:Hmmr	UTSW	11	40721840	missense	possibly damaging	0.90
R5795:Hmmr	UTSW	11	40721906	missense	probably damaging	1.00
R5873:Hmmr	UTSW	11	40707700	missense	probably damaging	0.99
R6414:Hmmr	UTSW	11	40715867	critical splice donor site	probably null
R6962:Hmmr	UTSW	11	40707415	missense	probably damaging	1.00
R7391:Hmmr	UTSW	11	40707786	splice site	probably null
R7558:Hmmr	UTSW	11	40733329	missense	probably damaging	1.00
R7965:Hmmr	UTSW	11	40715429	splice site	probably null
R8066:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8255:Hmmr	UTSW	11	40707435	missense	probably damaging	1.00
R8303:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8304:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8306:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8307:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8308:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8387:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8743:Hmmr	UTSW	11	40708031	missense	probably damaging	1.00
R8817:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8820:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8829:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8831:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8838:Hmmr	UTSW	11	40714027	missense	probably benign	0.00
R9312:Hmmr	UTSW	11	40723489	missense	possibly damaging	0.77
R9453:Hmmr	UTSW	11	40721828	critical splice donor site	probably null
R9468:Hmmr	UTSW	11	40723487	nonsense	probably null
R9601:Hmmr	UTSW	11	40707383	nonsense	probably null
T0975:Hmmr	UTSW	11	40723416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAAAGCTGGGCTGTTTTCAG -3'
(R):5'- GCCTGGAATTGATGAAACTCAG -3'

Sequencing Primer
(F):5'- CTGTTTTCAGTATAACGAAACGAGG -3'
(R):5'- AATAAGAGAGAGACAAAGATGAGGG -3'

Posted On

2020-01-23