Incidental Mutation 'R8065:Ebf1'
ID 619954
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Name early B cell factor 1
Synonyms Olf1, O/E-1, Olf-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 44617317-45008091 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44620547 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 90 (V90M)
Ref Sequence ENSEMBL: ENSMUSP00000099857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
AlphaFold Q07802
Predicted Effect probably benign
Transcript: ENSMUST00000081265
AA Change: V90M

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: V90M

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101326
AA Change: V90M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: V90M

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109268
AA Change: V90M

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: V90M

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Befuddled UTSW 11 44632775 missense probably damaging 0.98
Catastrophic UTSW 11 44883885 missense probably damaging 1.00
Crabapple UTSW 11 44883839 missense probably damaging 1.00
Crater_lake UTSW 11 44972908 nonsense probably null
ebby UTSW 11 44883814 missense probably damaging 1.00
Oregano UTSW 11 44869169 missense probably damaging 1.00
Oregano2 UTSW 11 44990504 splice site probably null
Realtor UTSW 11 44620547 missense probably benign 0.05
Vie UTSW 11 44972915 missense probably damaging 1.00
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R4904:Ebf1 UTSW 11 44869169 missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44992401 missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44996171 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44621968 missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44991511 missense probably damaging 0.99
R8067:Ebf1 UTSW 11 44620547 missense probably benign 0.05
R8125:Ebf1 UTSW 11 44972915 missense probably damaging 1.00
R8413:Ebf1 UTSW 11 44643447 missense possibly damaging 0.92
R8863:Ebf1 UTSW 11 44883839 missense probably damaging 1.00
R9178:Ebf1 UTSW 11 44992449 missense probably benign 0.04
R9178:Ebf1 UTSW 11 45004721 missense probably benign 0.20
R9511:Ebf1 UTSW 11 44924566 missense probably benign 0.03
R9603:Ebf1 UTSW 11 44618179 start codon destroyed probably null 0.07
Predicted Primers PCR Primer
(F):5'- GCTTAGCCATCTAACTCTGCG -3'
(R):5'- AGACTCAAGTAGGGTTCCGC -3'

Sequencing Primer
(F):5'- AGCCATCTAACTCTGCGTCTTTGG -3'
(R):5'- GGAGTGTGAGCAAACCTTT -3'
Posted On 2020-01-23