Incidental Mutation 'R8065:Ube2g1'
ID 619957
Institutional Source Beutler Lab
Gene Symbol Ube2g1
Ensembl Gene ENSMUSG00000020794
Gene Name ubiquitin-conjugating enzyme E2G 1
Synonyms D130023C12Rik, 2700059C12Rik
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72498109-72577307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72568591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 103 (G103D)
Ref Sequence ENSEMBL: ENSMUSP00000021148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021148] [ENSMUST00000138247]
AlphaFold P62254
Predicted Effect probably benign
Transcript: ENSMUST00000021148
AA Change: G103D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021148
Gene: ENSMUSG00000020794
AA Change: G103D

DomainStartEndE-ValueType
UBCc 8 166 2.54e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138247
AA Change: G32D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117588
Gene: ENSMUSG00000020794
AA Change: G32D

DomainStartEndE-ValueType
UBCc 1 95 6.89e-8 SMART
Meta Mutation Damage Score 0.3712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family and catalyzes the covalent attachment of ubiquitin to other proteins. The protein may be involved in degradation of muscle-specific proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Ube2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Amore UTSW 11 72,553,943 (GRCm39) start gained probably benign
oboe UTSW 11 72,568,591 (GRCm39) missense probably benign 0.04
R0408:Ube2g1 UTSW 11 72,563,791 (GRCm39) missense probably damaging 1.00
R6360:Ube2g1 UTSW 11 72,553,908 (GRCm39) missense probably damaging 0.97
R7270:Ube2g1 UTSW 11 72,553,939 (GRCm39) missense possibly damaging 0.59
R9375:Ube2g1 UTSW 11 72,553,943 (GRCm39) start gained probably benign
R9749:Ube2g1 UTSW 11 72,570,199 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGTGGCTCTTGTACATTTGGTAAAATC -3'
(R):5'- GCCAACTAGTTCAAATTTGCTATGGC -3'

Sequencing Primer
(F):5'- TTACATTTAGGAAATCTCCACGTAAG -3'
(R):5'- ACAATATCTGGCTTTTCATAACCAC -3'
Posted On 2020-01-23