Incidental Mutation 'R8065:Ube2g1'
ID 619957
Institutional Source Beutler Lab
Gene Symbol Ube2g1
Ensembl Gene ENSMUSG00000020794
Gene Name ubiquitin-conjugating enzyme E2G 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72607283-72686481 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72677765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 103 (G103D)
Ref Sequence ENSEMBL: ENSMUSP00000021148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021148] [ENSMUST00000138247]
AlphaFold P62254
Predicted Effect probably benign
Transcript: ENSMUST00000021148
AA Change: G103D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021148
Gene: ENSMUSG00000020794
AA Change: G103D

DomainStartEndE-ValueType
UBCc 8 166 2.54e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138247
AA Change: G32D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117588
Gene: ENSMUSG00000020794
AA Change: G32D

DomainStartEndE-ValueType
UBCc 1 95 6.89e-8 SMART
Meta Mutation Damage Score 0.3712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family and catalyzes the covalent attachment of ubiquitin to other proteins. The protein may be involved in degradation of muscle-specific proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Ube2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Amore UTSW 11 72663117 start gained probably benign
oboe UTSW 11 72677765 missense probably benign 0.04
R0408:Ube2g1 UTSW 11 72672965 missense probably damaging 1.00
R6360:Ube2g1 UTSW 11 72663082 missense probably damaging 0.97
R7270:Ube2g1 UTSW 11 72663113 missense possibly damaging 0.59
R9375:Ube2g1 UTSW 11 72663117 start gained probably benign
R9749:Ube2g1 UTSW 11 72679373 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGTGGCTCTTGTACATTTGGTAAAATC -3'
(R):5'- GCCAACTAGTTCAAATTTGCTATGGC -3'

Sequencing Primer
(F):5'- TTACATTTAGGAAATCTCCACGTAAG -3'
(R):5'- ACAATATCTGGCTTTTCATAACCAC -3'
Posted On 2020-01-23