Incidental Mutation 'R8065:Timm22'
ID 619958
Institutional Source Beutler Lab
Gene Symbol Timm22
Ensembl Gene ENSMUSG00000020843
Gene Name translocase of inner mitochondrial membrane 22
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76406952-76416292 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76414105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 190 (D190N)
Ref Sequence ENSEMBL: ENSMUSP00000021203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021203] [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408] [ENSMUST00000120699] [ENSMUST00000152183] [ENSMUST00000164102]
AlphaFold Q9CQ85
Predicted Effect probably damaging
Transcript: ENSMUST00000021203
AA Change: D190N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021203
Gene: ENSMUSG00000020843
AA Change: D190N

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Tim17 68 190 1.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065028
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072740
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094012
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108407
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108408
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120699
AA Change: D137N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113238
Gene: ENSMUSG00000020843
AA Change: D137N

DomainStartEndE-ValueType
Pfam:Tim17 12 140 4.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152183
SMART Domains Protein: ENSMUSP00000123281
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164102
SMART Domains Protein: ENSMUSP00000132836
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Meta Mutation Damage Score 0.6849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multipass transmembrane proteins are brought into mitochondria and inserted into the mitochondrial inner membrane by way of the TIM22 complex. This complex has six subunits and is a twin-pore translocase. The protein encoded by this gene is a subunit of TIM22 and represents the voltage-activated and signal-gated channel. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Timm22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Timm22 APN 11 76407437 missense probably damaging 0.98
obsidian UTSW 11 76407119 missense probably benign 0.00
warsling UTSW 11 76414105 missense probably damaging 1.00
R2851:Timm22 UTSW 11 76414099 missense probably damaging 0.97
R6362:Timm22 UTSW 11 76411127 missense probably damaging 0.98
R6388:Timm22 UTSW 11 76407119 missense probably benign 0.00
R6416:Timm22 UTSW 11 76411139 missense probably damaging 1.00
R6433:Timm22 UTSW 11 76409744 missense possibly damaging 0.82
R6707:Timm22 UTSW 11 76407325 missense possibly damaging 0.81
R7054:Timm22 UTSW 11 76407245 missense possibly damaging 0.82
R7469:Timm22 UTSW 11 76407308 missense probably benign 0.11
R9541:Timm22 UTSW 11 76409815 missense possibly damaging 0.70
R9569:Timm22 UTSW 11 76407370 missense probably benign 0.06
Z1186:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1187:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1188:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1189:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1190:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1192:Timm22 UTSW 11 76407117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACGAGGCAGCATAGTTCGG -3'
(R):5'- CCTGGTTGGAATTCAAGTGGAAAAG -3'

Sequencing Primer
(F):5'- GGCAGCATAGTTCGGATGATTTAAC -3'
(R):5'- TTCCAATGGCTGCAGAGAGC -3'
Posted On 2020-01-23