Incidental Mutation 'R8065:Timm22'
ID 619958
Institutional Source Beutler Lab
Gene Symbol Timm22
Ensembl Gene ENSMUSG00000020843
Gene Name translocase of inner mitochondrial membrane 22
Synonyms 2610511O07Rik
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76297778-76307118 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76304931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 190 (D190N)
Ref Sequence ENSEMBL: ENSMUSP00000021203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021203] [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408] [ENSMUST00000120699] [ENSMUST00000152183] [ENSMUST00000164102]
AlphaFold Q9CQ85
Predicted Effect probably damaging
Transcript: ENSMUST00000021203
AA Change: D190N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021203
Gene: ENSMUSG00000020843
AA Change: D190N

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Tim17 68 190 1.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065028
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072740
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094012
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108407
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108408
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120699
AA Change: D137N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113238
Gene: ENSMUSG00000020843
AA Change: D137N

DomainStartEndE-ValueType
Pfam:Tim17 12 140 4.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152183
SMART Domains Protein: ENSMUSP00000123281
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164102
SMART Domains Protein: ENSMUSP00000132836
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Meta Mutation Damage Score 0.6849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multipass transmembrane proteins are brought into mitochondria and inserted into the mitochondrial inner membrane by way of the TIM22 complex. This complex has six subunits and is a twin-pore translocase. The protein encoded by this gene is a subunit of TIM22 and represents the voltage-activated and signal-gated channel. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Myo15b G A 11: 115,778,769 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Timm22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Timm22 APN 11 76,298,263 (GRCm39) missense probably damaging 0.98
obsidian UTSW 11 76,297,945 (GRCm39) missense probably benign 0.00
warsling UTSW 11 76,304,931 (GRCm39) missense probably damaging 1.00
R2851:Timm22 UTSW 11 76,304,925 (GRCm39) missense probably damaging 0.97
R6362:Timm22 UTSW 11 76,301,953 (GRCm39) missense probably damaging 0.98
R6388:Timm22 UTSW 11 76,297,945 (GRCm39) missense probably benign 0.00
R6416:Timm22 UTSW 11 76,301,965 (GRCm39) missense probably damaging 1.00
R6433:Timm22 UTSW 11 76,300,570 (GRCm39) missense possibly damaging 0.82
R6707:Timm22 UTSW 11 76,298,151 (GRCm39) missense possibly damaging 0.81
R7054:Timm22 UTSW 11 76,298,071 (GRCm39) missense possibly damaging 0.82
R7469:Timm22 UTSW 11 76,298,134 (GRCm39) missense probably benign 0.11
R9541:Timm22 UTSW 11 76,300,641 (GRCm39) missense possibly damaging 0.70
R9569:Timm22 UTSW 11 76,298,196 (GRCm39) missense probably benign 0.06
Z1186:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Z1187:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Z1188:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Z1189:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Z1190:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Z1192:Timm22 UTSW 11 76,297,943 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACGAGGCAGCATAGTTCGG -3'
(R):5'- CCTGGTTGGAATTCAAGTGGAAAAG -3'

Sequencing Primer
(F):5'- GGCAGCATAGTTCGGATGATTTAAC -3'
(R):5'- TTCCAATGGCTGCAGAGAGC -3'
Posted On 2020-01-23