Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Ssh2'

619959

Institutional Source

Beutler Lab

Gene Symbol

Ssh2

Ensembl Gene

ENSMUSG00000037926

Gene Name

slingshot protein phosphatase 2

Synonyms

SSH-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77216287-77460220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77441985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 431 (R431G)

Ref Sequence

ENSEMBL: ENSMUSP00000137933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]

AlphaFold

Q5SW75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037912
AA Change: R425G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: R425G

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
Pfam:DEK_C	251	302	3.1e-13	PFAM
DSPc	307	445	2.2e-41	SMART
low complexity region	459	469	N/A	INTRINSIC
low complexity region	871	882	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000181283
AA Change: R431G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: R431G

Domain	Start	End	E-Value	Type
Pfam:DEK_C	256	309	1.7e-18	PFAM
DSPc	313	451	2.2e-41	SMART
low complexity region	465	475	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1376	1391	N/A	INTRINSIC

Meta Mutation Damage Score

0.8719

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Ssh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Ssh2	APN	11	77441926	missense	probably damaging	1.00
IGL01141:Ssh2	APN	11	77449726	missense	probably damaging	1.00
IGL01520:Ssh2	APN	11	77449906	missense	probably damaging	1.00
IGL01803:Ssh2	APN	11	77425330	missense	probably damaging	0.99
IGL01989:Ssh2	APN	11	77453685	missense	possibly damaging	0.79
IGL02322:Ssh2	APN	11	77416413	critical splice acceptor site	probably null
IGL02466:Ssh2	APN	11	77416407	splice site	probably benign
IGL02683:Ssh2	APN	11	77398256	missense	probably damaging	0.99
IGL02706:Ssh2	APN	11	77453406	missense	possibly damaging	0.68
IGL02719:Ssh2	APN	11	77425587	missense	probably damaging	1.00
IGL02721:Ssh2	APN	11	77454725	nonsense	probably null
IGL02732:Ssh2	APN	11	77437776	splice site	probably null
IGL02745:Ssh2	APN	11	77455407	missense	probably damaging	1.00
IGL02993:Ssh2	APN	11	77453544	missense	probably damaging	1.00
IGL03000:Ssh2	APN	11	77421206	splice site	probably benign
david	UTSW	11	77425593	missense	probably damaging	1.00
faba	UTSW	11	77441985	missense	probably damaging	1.00
goliath	UTSW	11	77453523	missense	possibly damaging	0.48
Vicia	UTSW	11	77454966	missense	possibly damaging	0.68
IGL03055:Ssh2	UTSW	11	77408195	nonsense	probably null
R0024:Ssh2	UTSW	11	77454966	missense	possibly damaging	0.68
R0374:Ssh2	UTSW	11	77408143	missense	probably damaging	1.00
R0539:Ssh2	UTSW	11	77454794	missense	probably benign	0.11
R0834:Ssh2	UTSW	11	77437633	missense	possibly damaging	0.87
R1714:Ssh2	UTSW	11	77454024	missense	possibly damaging	0.94
R1743:Ssh2	UTSW	11	77437756	missense	probably damaging	1.00
R1889:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R1895:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R3945:Ssh2	UTSW	11	77454668	missense	possibly damaging	0.93
R3947:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R3948:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R4133:Ssh2	UTSW	11	77421269	missense	probably damaging	1.00
R4256:Ssh2	UTSW	11	77408183	missense	possibly damaging	0.48
R4499:Ssh2	UTSW	11	77393067	nonsense	probably null
R4548:Ssh2	UTSW	11	77450184	missense	probably benign	0.20
R4644:Ssh2	UTSW	11	77449576	missense	possibly damaging	0.46
R4690:Ssh2	UTSW	11	77455205	missense	possibly damaging	0.62
R4788:Ssh2	UTSW	11	77429798	missense	probably damaging	1.00
R4919:Ssh2	UTSW	11	77425320	missense	possibly damaging	0.91
R5014:Ssh2	UTSW	11	77455276	nonsense	probably null
R5380:Ssh2	UTSW	11	77453945	missense	probably benign	0.01
R5574:Ssh2	UTSW	11	77450115	missense	probably benign
R5593:Ssh2	UTSW	11	77421366	missense	probably damaging	0.99
R5739:Ssh2	UTSW	11	77449813	missense	probably damaging	1.00
R6180:Ssh2	UTSW	11	77453465	missense	probably benign	0.43
R6542:Ssh2	UTSW	11	77450150	missense	possibly damaging	0.94
R6713:Ssh2	UTSW	11	77449433	missense	possibly damaging	0.89
R7108:Ssh2	UTSW	11	77454794	missense	probably benign
R7124:Ssh2	UTSW	11	77454338	missense	probably benign	0.00
R7255:Ssh2	UTSW	11	77425593	missense	probably damaging	1.00
R7332:Ssh2	UTSW	11	77453523	missense	possibly damaging	0.48
R7362:Ssh2	UTSW	11	77449650	missense	probably benign	0.01
R7395:Ssh2	UTSW	11	77393073	missense	probably damaging	0.99
R7412:Ssh2	UTSW	11	77450108	missense	probably damaging	0.98
R7493:Ssh2	UTSW	11	77437716	missense	probably benign	0.16
R7686:Ssh2	UTSW	11	77425324	missense	possibly damaging	0.89
R7870:Ssh2	UTSW	11	77453615	missense	probably benign
R7895:Ssh2	UTSW	11	77454626	missense	probably benign	0.41
R7963:Ssh2	UTSW	11	77421356	missense	possibly damaging	0.93
R8030:Ssh2	UTSW	11	77454506	missense	probably benign	0.01
R8099:Ssh2	UTSW	11	77454929	nonsense	probably null
R8294:Ssh2	UTSW	11	77454201	missense	probably benign	0.08
R8464:Ssh2	UTSW	11	77454253	nonsense	probably null
R8469:Ssh2	UTSW	11	77449608	missense	probably benign	0.41
R8547:Ssh2	UTSW	11	77449707	missense	probably benign	0.10
R8677:Ssh2	UTSW	11	77455193	missense	possibly damaging	0.77
R8758:Ssh2	UTSW	11	77454017	missense	probably benign
R9029:Ssh2	UTSW	11	77437628	missense	probably damaging	1.00
R9030:Ssh2	UTSW	11	77421236	missense	possibly damaging	0.63
R9126:Ssh2	UTSW	11	77455276	nonsense	probably null
R9146:Ssh2	UTSW	11	77437676	missense	probably damaging	0.98
R9377:Ssh2	UTSW	11	77408148	missense	possibly damaging	0.95
R9483:Ssh2	UTSW	11	77393150	missense	possibly damaging	0.81
R9615:Ssh2	UTSW	11	77425377	missense	possibly damaging	0.48
RF018:Ssh2	UTSW	11	77454054	missense	probably damaging	0.99
X0017:Ssh2	UTSW	11	77441898	missense	probably damaging	1.00
Z1088:Ssh2	UTSW	11	77449495	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACCCCAGCTCTTACACTG -3'
(R):5'- AGCCAGAGGATTTCAGCCTG -3'

Sequencing Primer
(F):5'- AGCTCTTACACTGTACTATCAGCG -3'
(R):5'- GATTTCAGCCTGTGACAGCTCAAG -3'

Posted On

2020-01-23