Incidental Mutation 'R8065:Myo15b'
ID 619960
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Name myosin XVB
Synonyms LOC217328, LOC380737, E330039G21Rik
MMRRC Submission 067501-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 115749232-115783429 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 115778769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000140174] [ENSMUST00000167507] [ENSMUST00000222123]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021097
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040703
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,791,337 (GRCm39) V280A probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Diaph3 A T 14: 87,274,931 (GRCm39) L175Q probably damaging Het
Dlat A T 9: 50,569,149 (GRCm39) M218K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Flrt2 A G 12: 95,747,548 (GRCm39) T629A probably benign Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hsd17b4 A T 18: 50,303,819 (GRCm39) I431F possibly damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Ibtk A C 9: 85,602,916 (GRCm39) S696R probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Ldlr T A 9: 21,649,241 (GRCm39) C339S probably damaging Het
Myh2 G A 11: 67,072,170 (GRCm39) E633K probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Naip2 A T 13: 100,325,730 (GRCm39) S59R probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Pskh1 T G 8: 106,656,487 (GRCm39) S388A possibly damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Slc17a3 A G 13: 24,042,070 (GRCm39) R491G unknown Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Ssh2 A G 11: 77,332,811 (GRCm39) R431G probably damaging Het
Timm22 G A 11: 76,304,931 (GRCm39) D190N probably damaging Het
Ube2g1 G A 11: 72,568,591 (GRCm39) G103D probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp105 A G 9: 122,754,194 (GRCm39) T8A probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115,782,742 (GRCm39) missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115,760,330 (GRCm39) nonsense probably null
IGL01539:Myo15b APN 11 115,754,299 (GRCm39) missense probably benign 0.43
IGL01895:Myo15b APN 11 115,774,324 (GRCm39) missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115,777,109 (GRCm39) missense probably damaging 1.00
IGL02343:Myo15b APN 11 115,764,226 (GRCm39) unclassified probably benign
IGL02349:Myo15b APN 11 115,753,931 (GRCm39) splice site probably benign
IGL02368:Myo15b APN 11 115,767,828 (GRCm39) missense probably benign 0.13
IGL02576:Myo15b APN 11 115,780,879 (GRCm39) missense probably null 0.97
IGL02650:Myo15b APN 11 115,777,337 (GRCm39) critical splice donor site probably null
IGL02661:Myo15b APN 11 115,774,895 (GRCm39) missense probably benign 0.01
IGL02716:Myo15b APN 11 115,774,535 (GRCm39) missense probably benign 0.06
IGL02733:Myo15b APN 11 115,775,076 (GRCm39) missense probably benign 0.00
IGL02951:Myo15b APN 11 115,772,127 (GRCm39) missense probably damaging 1.00
IGL03017:Myo15b APN 11 115,778,743 (GRCm39) missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115,762,469 (GRCm39) missense probably benign 0.08
ANU74:Myo15b UTSW 11 115,769,239 (GRCm39) missense probably damaging 1.00
R0092:Myo15b UTSW 11 115,753,812 (GRCm39) missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115,777,109 (GRCm39) missense probably damaging 1.00
R0325:Myo15b UTSW 11 115,775,091 (GRCm39) missense probably damaging 1.00
R0614:Myo15b UTSW 11 115,773,739 (GRCm39) missense probably damaging 1.00
R0652:Myo15b UTSW 11 115,755,468 (GRCm39) missense probably benign 0.07
R0711:Myo15b UTSW 11 115,774,664 (GRCm39) missense probably damaging 1.00
R0815:Myo15b UTSW 11 115,757,162 (GRCm39) splice site probably benign
R0961:Myo15b UTSW 11 115,773,280 (GRCm39) missense probably benign 0.15
R1066:Myo15b UTSW 11 115,770,577 (GRCm39) missense probably benign 0.03
R1221:Myo15b UTSW 11 115,777,546 (GRCm39) missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115,771,327 (GRCm39) missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115,774,318 (GRCm39) small deletion probably benign
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1317:Myo15b UTSW 11 115,774,460 (GRCm39) missense probably null 0.14
R1491:Myo15b UTSW 11 115,777,683 (GRCm39) splice site probably null
R1552:Myo15b UTSW 11 115,757,461 (GRCm39) missense probably benign 0.08
R1731:Myo15b UTSW 11 115,782,386 (GRCm39) missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115,771,335 (GRCm39) critical splice donor site probably null
R1843:Myo15b UTSW 11 115,760,412 (GRCm39) missense probably benign 0.04
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1894:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1917:Myo15b UTSW 11 115,773,080 (GRCm39) missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115,754,310 (GRCm39) missense probably benign 0.30
R1939:Myo15b UTSW 11 115,778,529 (GRCm39) missense probably benign 0.00
R1945:Myo15b UTSW 11 115,769,224 (GRCm39) missense probably damaging 1.00
R1986:Myo15b UTSW 11 115,773,701 (GRCm39) missense probably benign 0.31
R2130:Myo15b UTSW 11 115,762,469 (GRCm39) missense probably benign 0.08
R2138:Myo15b UTSW 11 115,774,633 (GRCm39) missense probably benign 0.00
R2176:Myo15b UTSW 11 115,757,398 (GRCm39) missense probably damaging 1.00
R2415:Myo15b UTSW 11 115,770,390 (GRCm39) missense probably benign 0.00
R2483:Myo15b UTSW 11 115,755,565 (GRCm39) missense probably benign 0.04
R3620:Myo15b UTSW 11 115,762,013 (GRCm39) missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115,754,239 (GRCm39) missense probably benign 0.01
R4013:Myo15b UTSW 11 115,762,282 (GRCm39) nonsense probably null
R4021:Myo15b UTSW 11 115,764,331 (GRCm39) missense probably benign 0.07
R4119:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4120:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4499:Myo15b UTSW 11 115,781,778 (GRCm39) missense probably benign 0.00
R4653:Myo15b UTSW 11 115,770,813 (GRCm39) critical splice donor site probably null
R4655:Myo15b UTSW 11 115,781,523 (GRCm39) missense probably damaging 1.00
R4700:Myo15b UTSW 11 115,752,761 (GRCm39) missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115,774,834 (GRCm39) missense probably benign 0.01
R4777:Myo15b UTSW 11 115,770,478 (GRCm39) missense probably damaging 0.99
R4833:Myo15b UTSW 11 115,778,428 (GRCm39) missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115,757,482 (GRCm39) missense probably benign 0.01
R5121:Myo15b UTSW 11 115,776,880 (GRCm39) missense probably damaging 1.00
R5146:Myo15b UTSW 11 115,782,024 (GRCm39) missense probably benign 0.00
R5535:Myo15b UTSW 11 115,772,127 (GRCm39) missense probably damaging 1.00
R5647:Myo15b UTSW 11 115,762,337 (GRCm39) missense probably damaging 0.99
R5849:Myo15b UTSW 11 115,772,759 (GRCm39) missense probably damaging 1.00
R5882:Myo15b UTSW 11 115,760,422 (GRCm39) missense probably damaging 1.00
R5956:Myo15b UTSW 11 115,764,583 (GRCm39) missense probably benign 0.34
R6273:Myo15b UTSW 11 115,753,625 (GRCm39) missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115,777,065 (GRCm39) missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115,781,657 (GRCm39) missense probably damaging 1.00
R6462:Myo15b UTSW 11 115,750,268 (GRCm39) missense probably benign 0.01
R6792:Myo15b UTSW 11 115,775,923 (GRCm39) missense probably damaging 1.00
R6963:Myo15b UTSW 11 115,781,540 (GRCm39) splice site probably null
R7015:Myo15b UTSW 11 115,762,670 (GRCm39) missense
R7020:Myo15b UTSW 11 115,757,493 (GRCm39) nonsense probably null
R7096:Myo15b UTSW 11 115,782,324 (GRCm39) splice site probably null
R7219:Myo15b UTSW 11 115,767,921 (GRCm39) critical splice donor site probably null
R7400:Myo15b UTSW 11 115,750,939 (GRCm39) missense
R7413:Myo15b UTSW 11 115,768,970 (GRCm39) missense
R7483:Myo15b UTSW 11 115,749,570 (GRCm39) missense
R7523:Myo15b UTSW 11 115,781,684 (GRCm39) missense unknown
R7737:Myo15b UTSW 11 115,778,749 (GRCm39) missense unknown
R7784:Myo15b UTSW 11 115,752,166 (GRCm39) missense
R7842:Myo15b UTSW 11 115,762,321 (GRCm39) missense
R7921:Myo15b UTSW 11 115,778,004 (GRCm39) nonsense probably null
R8183:Myo15b UTSW 11 115,773,843 (GRCm39) splice site probably null
R8193:Myo15b UTSW 11 115,775,973 (GRCm39) missense probably damaging 1.00
R8237:Myo15b UTSW 11 115,767,827 (GRCm39) missense
R8430:Myo15b UTSW 11 115,773,049 (GRCm39) missense probably benign 0.02
R8482:Myo15b UTSW 11 115,774,083 (GRCm39) nonsense probably null
R8515:Myo15b UTSW 11 115,749,610 (GRCm39) missense
R8798:Myo15b UTSW 11 115,754,232 (GRCm39) missense
R8937:Myo15b UTSW 11 115,773,127 (GRCm39) missense probably benign 0.00
R8975:Myo15b UTSW 11 115,781,780 (GRCm39) missense unknown
R9045:Myo15b UTSW 11 115,783,178 (GRCm39) makesense probably null
R9117:Myo15b UTSW 11 115,778,743 (GRCm39) missense possibly damaging 0.91
R9185:Myo15b UTSW 11 115,771,255 (GRCm39) missense unknown
R9226:Myo15b UTSW 11 115,750,924 (GRCm39) missense
R9302:Myo15b UTSW 11 115,776,238 (GRCm39) missense possibly damaging 0.83
R9318:Myo15b UTSW 11 115,775,965 (GRCm39) missense probably benign 0.26
R9336:Myo15b UTSW 11 115,771,064 (GRCm39) missense
R9337:Myo15b UTSW 11 115,749,861 (GRCm39) missense
R9338:Myo15b UTSW 11 115,762,238 (GRCm39) missense
R9498:Myo15b UTSW 11 115,770,784 (GRCm39) missense
R9500:Myo15b UTSW 11 115,777,466 (GRCm39) missense probably damaging 0.98
R9602:Myo15b UTSW 11 115,769,269 (GRCm39) critical splice donor site probably null
R9642:Myo15b UTSW 11 115,772,335 (GRCm39) missense possibly damaging 0.67
X0020:Myo15b UTSW 11 115,762,625 (GRCm39) critical splice acceptor site probably null
Z1176:Myo15b UTSW 11 115,778,751 (GRCm39) missense unknown
Z1176:Myo15b UTSW 11 115,774,278 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TAAAAGTCCCACGGCGTCAC -3'
(R):5'- TTCCCAAACTGGCAGATGGG -3'

Sequencing Primer
(F):5'- CCAGGTCATTGGTCTTACCGTG -3'
(R):5'- AGGTCCAAAGCACTGTGC -3'
Posted On 2020-01-23