Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Slc17a3'

619962

Institutional Source

Beutler Lab

Gene Symbol

Slc17a3

Ensembl Gene

ENSMUSG00000036083

Gene Name

solute carrier family 17 (sodium phosphate), member 3

Synonyms

Npt4

MMRRC Submission

067501-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23839434-23860716 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23858087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 491 (R491G)

Ref Sequence

ENSEMBL: ENSMUSP00000039062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]

AlphaFold

G3UWD9

Predicted Effect

unknown
Transcript: ENSMUST00000039721
AA Change: R491G

SMART Domains

Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: R491G

Domain	Start	End	E-Value	Type
Pfam:MFS_1	45	377	3.3e-46	PFAM
transmembrane domain	393	415	N/A	INTRINSIC
transmembrane domain	430	452	N/A	INTRINSIC
transmembrane domain	459	481	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: R413G

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
Pfam:MFS_1	95	293	2.8e-25	PFAM
transmembrane domain	310	332	N/A	INTRINSIC
transmembrane domain	352	369	N/A	INTRINSIC
transmembrane domain	379	398	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: R455G

Domain	Start	End	E-Value	Type
Pfam:MFS_1	39	425	6.7e-47	PFAM
transmembrane domain	453	475	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000166467
AA Change: R491G

SMART Domains

Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: R491G

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	338	2.3e-46	PFAM
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Slc17a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Slc17a3	APN	13	23856481	missense	probably benign	0.20
IGL02569:Slc17a3	APN	13	23846302	missense	probably damaging	1.00
IGL02628:Slc17a3	APN	13	23842451	start codon destroyed	probably null	1.00
IGL02745:Slc17a3	APN	13	23842486	missense	probably benign	0.01
IGL03001:Slc17a3	APN	13	23856784	missense	probably damaging	1.00
IGL03143:Slc17a3	APN	13	23855979	splice site	probably null
IGL03144:Slc17a3	APN	13	23846440	missense	probably benign	0.00
R0052:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0054:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0152:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0153:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0233:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0234:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0257:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0294:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0295:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0318:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0319:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0352:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0462:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0610:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0627:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0652:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0765:Slc17a3	UTSW	13	23846896	nonsense	probably null
R1529:Slc17a3	UTSW	13	23845445	missense	probably damaging	1.00
R1532:Slc17a3	UTSW	13	23856500	missense	probably damaging	1.00
R1569:Slc17a3	UTSW	13	23855608	missense	probably benign	0.09
R1640:Slc17a3	UTSW	13	23852357	nonsense	probably null
R1643:Slc17a3	UTSW	13	23857198	splice site	probably benign
R1715:Slc17a3	UTSW	13	23856741	missense	probably benign	0.19
R2407:Slc17a3	UTSW	13	23852435	critical splice donor site	probably null
R2512:Slc17a3	UTSW	13	23846247	missense	probably benign	0.13
R3923:Slc17a3	UTSW	13	23858054	missense	possibly damaging	0.89
R4449:Slc17a3	UTSW	13	23856732	missense	probably damaging	0.99
R5166:Slc17a3	UTSW	13	23842542	critical splice donor site	probably null
R5748:Slc17a3	UTSW	13	23856466	missense	probably damaging	1.00
R5989:Slc17a3	UTSW	13	23842428	start gained	probably benign
R6281:Slc17a3	UTSW	13	23856799	missense	probably benign	0.17
R6811:Slc17a3	UTSW	13	23855941	missense	possibly damaging	0.61
R7283:Slc17a3	UTSW	13	23855848	missense
R7341:Slc17a3	UTSW	13	23846884	nonsense	probably null
R7467:Slc17a3	UTSW	13	23846967	critical splice donor site	probably null
R7485:Slc17a3	UTSW	13	23855849	missense
R8770:Slc17a3	UTSW	13	23855624	missense
R8809:Slc17a3	UTSW	13	23855592	nonsense	probably null
R8867:Slc17a3	UTSW	13	23855960	missense

Predicted Primers

PCR Primer
(F):5'- AAAGCCCTCTGGAAACTGTC -3'
(R):5'- TCTTCAAAAGAAGTCTGGGTGAAAG -3'

Sequencing Primer
(F):5'- CCTCTGGAAACTGTCGTCTGAATG -3'
(R):5'- TTTCATGAAAGTCTTCCCACAGAGG -3'

Posted On

2020-01-23