Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Naip2'

619964

Institutional Source

Beutler Lab

Gene Symbol

Naip2

Ensembl Gene

ENSMUSG00000078945

Gene Name

NLR family, apoptosis inhibitory protein 2

Synonyms

Birc1b, Naip2, Naip-rs6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100144063-100202092 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100189222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 59 (S59R)

Ref Sequence

ENSEMBL: ENSMUSP00000070827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]

AlphaFold

Q9QUK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000067975
AA Change: S59R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: S59R

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117913
AA Change: S59R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: S59R

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167986
AA Change: S59R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: S59R

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	8.6e-35	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Naip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Naip2	APN	13	100154887	missense	probably benign	0.00
IGL00676:Naip2	APN	13	100152632	missense	probably damaging	1.00
IGL00870:Naip2	APN	13	100152060	splice site	probably benign
IGL00908:Naip2	APN	13	100160649	missense	probably benign	0.01
IGL00916:Naip2	APN	13	100161431	missense	probably damaging	0.97
IGL00949:Naip2	APN	13	100161591	missense	probably damaging	1.00
IGL01010:Naip2	APN	13	100154938	missense	probably damaging	0.99
IGL01642:Naip2	APN	13	100160937	missense	probably damaging	0.97
IGL01884:Naip2	APN	13	100188821	splice site	probably benign
IGL01917:Naip2	APN	13	100162083	missense	probably benign	0.00
IGL02015:Naip2	APN	13	100161607	missense	possibly damaging	0.57
IGL02315:Naip2	APN	13	100161236	missense	probably damaging	1.00
IGL02328:Naip2	APN	13	100161369	missense	probably damaging	1.00
IGL02735:Naip2	APN	13	100160214	missense	probably damaging	0.99
IGL02738:Naip2	APN	13	100189177	missense	probably benign	0.01
IGL02887:Naip2	APN	13	100161512	missense	possibly damaging	0.90
IGL02894:Naip2	APN	13	100160997	missense	probably damaging	1.00
IGL02894:Naip2	APN	13	100183789	missense	probably benign
IGL02974:Naip2	APN	13	100161678	missense	probably damaging	1.00
IGL03024:Naip2	APN	13	100189354	missense	possibly damaging	0.50
IGL03056:Naip2	APN	13	100162287	missense	possibly damaging	0.90
IGL03281:Naip2	APN	13	100161620	missense	probably damaging	0.99
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0132:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0310:Naip2	UTSW	13	100148842	missense	probably damaging	1.00
R0367:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0368:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0422:Naip2	UTSW	13	100161113	missense	probably benign	0.10
R0441:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0445:Naip2	UTSW	13	100161887	missense	possibly damaging	0.91
R0446:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0464:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0466:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0467:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0486:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0533:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0853:Naip2	UTSW	13	100161854	missense	probably benign
R0853:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0855:Naip2	UTSW	13	100161854	missense	probably benign
R0855:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0904:Naip2	UTSW	13	100161854	missense	probably benign
R0904:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0906:Naip2	UTSW	13	100161854	missense	probably benign
R0906:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0908:Naip2	UTSW	13	100161854	missense	probably benign
R0908:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0959:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R0959:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R0962:Naip2	UTSW	13	100179385	missense	probably damaging	1.00
R1024:Naip2	UTSW	13	100161854	missense	probably benign
R1024:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1186:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1186:Naip2	UTSW	13	100162037	frame shift	probably null
R1217:Naip2	UTSW	13	100161854	missense	probably benign
R1217:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1340:Naip2	UTSW	13	100189122	missense	possibly damaging	0.80
R1342:Naip2	UTSW	13	100161854	missense	probably benign
R1342:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1404:Naip2	UTSW	13	100161854	missense	probably benign
R1423:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1423:Naip2	UTSW	13	100154847	intron	probably benign
R1423:Naip2	UTSW	13	100154872	missense	possibly damaging	0.59
R1423:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R1426:Naip2	UTSW	13	100161854	missense	probably benign
R1426:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1472:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155029	intron	probably benign
R1576:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1576:Naip2	UTSW	13	100155029	intron	probably benign
R1599:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1640:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1641:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1642:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1643:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1644:Naip2	UTSW	13	100182929	missense	possibly damaging	0.83
R1681:Naip2	UTSW	13	100161854	missense	probably benign
R1681:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1891:Naip2	UTSW	13	100154887	missense	probably benign	0.00
R1913:Naip2	UTSW	13	100152157	critical splice acceptor site	probably null
R1937:Naip2	UTSW	13	100161854	missense	probably benign
R1937:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1993:Naip2	UTSW	13	100162007	missense	probably benign	0.03
R2001:Naip2	UTSW	13	100144588	missense	probably damaging	1.00
R2055:Naip2	UTSW	13	100179372	missense	probably benign	0.07
R2198:Naip2	UTSW	13	100152592	missense	probably damaging	1.00
R2906:Naip2	UTSW	13	100161996	missense	probably damaging	1.00
R2931:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R3014:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3016:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3037:Naip2	UTSW	13	100154949	missense	probably benign	0.08
R3414:Naip2	UTSW	13	100189263	nonsense	probably null
R3437:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R3713:Naip2	UTSW	13	100161902	missense	probably damaging	1.00
R3806:Naip2	UTSW	13	100152634	missense	possibly damaging	0.92
R3847:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3847:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3891:Naip2	UTSW	13	100161098	missense	probably damaging	0.99
R4419:Naip2	UTSW	13	100160625	missense	probably benign	0.03
R4456:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4458:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4689:Naip2	UTSW	13	100148812	missense	probably damaging	1.00
R4797:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R4852:Naip2	UTSW	13	100161536	missense	probably benign
R4922:Naip2	UTSW	13	100154960	missense	probably benign
R5135:Naip2	UTSW	13	100179440	missense	probably damaging	0.98
R5185:Naip2	UTSW	13	100189351	missense	probably damaging	1.00
R5265:Naip2	UTSW	13	100152560	missense	probably damaging	1.00
R5451:Naip2	UTSW	13	100188860	missense	probably benign	0.12
R5521:Naip2	UTSW	13	100154914	missense	probably damaging	1.00
R5737:Naip2	UTSW	13	100161854	missense	probably benign	0.38
R6244:Naip2	UTSW	13	100152137	missense	probably damaging	1.00
R6478:Naip2	UTSW	13	100162041	missense	probably benign
R6480:Naip2	UTSW	13	100162041	missense	probably benign
R6481:Naip2	UTSW	13	100162041	missense	probably benign
R6490:Naip2	UTSW	13	100160685	missense	probably benign
R6653:Naip2	UTSW	13	100152136	missense	probably benign	0.00
R6653:Naip2	UTSW	13	100161844	missense	probably benign
R6768:Naip2	UTSW	13	100178324	nonsense	probably null
R6791:Naip2	UTSW	13	100154960	missense	probably benign
R6793:Naip2	UTSW	13	100154960	missense	probably benign
R6890:Naip2	UTSW	13	100162041	missense	probably benign
R7036:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R7213:Naip2	UTSW	13	100187483	missense	probably damaging	1.00
R7342:Naip2	UTSW	13	100189356	missense	probably benign	0.09
R7445:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R7572:Naip2	UTSW	13	100154960	missense	probably benign
R7699:Naip2	UTSW	13	100160369	missense	probably benign	0.00
R7840:Naip2	UTSW	13	100144409	missense	probably benign	0.14
R7874:Naip2	UTSW	13	100154951	missense	probably benign	0.00
R7874:Naip2	UTSW	13	100154960	missense	probably benign
R8038:Naip2	UTSW	13	100162062	missense	probably benign	0.00
R8094:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R8166:Naip2	UTSW	13	100162007	missense	probably benign	0.03
R8378:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R8669:Naip2	UTSW	13	100188969	missense	probably benign	0.05
R8691:Naip2	UTSW	13	100161168	missense	probably damaging	1.00
R8716:Naip2	UTSW	13	100144406	missense	probably benign
R8720:Naip2	UTSW	13	100162122	missense	probably benign	0.04
R8888:Naip2	UTSW	13	100189136	missense	probably benign	0.01
R8895:Naip2	UTSW	13	100189136	missense	probably benign	0.01
R9031:Naip2	UTSW	13	100178268	missense	possibly damaging	0.55
R9072:Naip2	UTSW	13	100154951	missense	probably benign	0.00
R9072:Naip2	UTSW	13	100154960	missense	probably benign
R9074:Naip2	UTSW	13	100154951	missense	probably benign	0.00
R9074:Naip2	UTSW	13	100154960	missense	probably benign
R9077:Naip2	UTSW	13	100154951	missense	probably benign	0.00
R9077:Naip2	UTSW	13	100154960	missense	probably benign
R9176:Naip2	UTSW	13	100162199	missense	probably damaging	1.00
R9219:Naip2	UTSW	13	100160705	missense	probably benign	0.06
R9358:Naip2	UTSW	13	100161572	missense	probably damaging	1.00
R9371:Naip2	UTSW	13	100161846	nonsense	probably null
R9414:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R9415:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R9416:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R9708:Naip2	UTSW	13	100161579	missense	probably damaging	0.99
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155029	intron	probably benign
X0063:Naip2	UTSW	13	100161758	missense	probably damaging	1.00
Y5405:Naip2	UTSW	13	100154960	missense	probably benign
Z1088:Naip2	UTSW	13	100161909	missense	probably benign
Z1176:Naip2	UTSW	13	100161593	missense	probably benign	0.02
Z1176:Naip2	UTSW	13	100161909	missense	probably benign
Z1177:Naip2	UTSW	13	100152629	missense	possibly damaging	0.65
Z1177:Naip2	UTSW	13	100161909	missense	probably benign
Z1177:Naip2	UTSW	13	100162865	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCGGATGTCATACTTGCCAAT -3'
(R):5'- CCCAGGGAGAAGCCGTTGA -3'

Sequencing Primer
(F):5'- AGGAACTCACATTCTGGTCG -3'
(R):5'- AAGCCGTTGAGGAGATAATTTGTG -3'

Posted On

2020-01-23