Incidental Mutation 'R8065:Chodl'
ID619968
Institutional Source Beutler Lab
Gene Symbol Chodl
Ensembl Gene ENSMUSG00000022860
Gene Namechondrolectin
SynonymsMT75, 3110074E07Rik, PRED12
MMRRC Submission
Accession Numbers

Genbank: NM_139134 ; MGI: 2179069

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8065 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78930948-78951733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78946713 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 229 (L229F)
Ref Sequence ENSEMBL: ENSMUSP00000063961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023568] [ENSMUST00000069148] [ENSMUST00000114216] [ENSMUST00000232415]
Predicted Effect probably damaging
Transcript: ENSMUST00000023568
AA Change: L229F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023568
Gene: ENSMUSG00000022860
AA Change: L229F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069148
AA Change: L229F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063961
Gene: ENSMUSG00000022860
AA Change: L229F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114216
AA Change: L229F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109854
Gene: ENSMUSG00000022860
AA Change: L229F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232415
AA Change: L224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2125 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein with a carbohydrate recognition domain characteristic of C-type lectins in its extracellular portion. In other proteins, this domain is involved in endocytosis of glycoproteins and exogenous sugar-bearing pathogens. This protein localizes predominantly to the perinuclear region. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Chodl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Chodl APN 16 78941263 missense probably damaging 1.00
IGL01632:Chodl APN 16 78944564 intron probably benign
IGL01968:Chodl APN 16 78941669 missense probably damaging 1.00
IGL03095:Chodl APN 16 78941433 missense probably damaging 1.00
R0125:Chodl UTSW 16 78941423 missense probably damaging 1.00
R1852:Chodl UTSW 16 78941258 missense probably benign 0.01
R1938:Chodl UTSW 16 78941426 missense possibly damaging 0.77
R2109:Chodl UTSW 16 78941363 missense possibly damaging 0.58
R4362:Chodl UTSW 16 78944658 critical splice donor site probably null
R4502:Chodl UTSW 16 78931444 missense possibly damaging 0.65
R5299:Chodl UTSW 16 78941408 missense probably damaging 0.99
R5386:Chodl UTSW 16 78946697 missense probably damaging 1.00
R5677:Chodl UTSW 16 78941315 missense probably damaging 1.00
R6959:Chodl UTSW 16 78946684 missense probably damaging 1.00
R7138:Chodl UTSW 16 78941447 missense probably damaging 1.00
R7147:Chodl UTSW 16 78946741 missense probably damaging 1.00
R8067:Chodl UTSW 16 78946713 missense probably damaging 1.00
R8193:Chodl UTSW 16 78941524 missense probably damaging 1.00
R8924:Chodl UTSW 16 78941771 missense possibly damaging 0.70
X0067:Chodl UTSW 16 78931373 missense possibly damaging 0.46
YA93:Chodl UTSW 16 78941282 missense probably benign 0.11
Z1177:Chodl UTSW 16 78941463 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GGGCTGTTTTCAAAGCATCC -3'
(R):5'- ATGCTGGAATTTTACTGACAGC -3'

Sequencing Primer
(F):5'- AACCTTGTATTGGGGTCC -3'
(R):5'- CCTTTAATTATCTGGACAGCAAT -3'
Posted On2020-01-23