Mutagenetix > Incidental Mutations

Incidental Mutation 'R8065:Chodl'

619968

Institutional Source

Beutler Lab

Gene Symbol

Chodl

Ensembl Gene

ENSMUSG00000022860

Gene Name

chondrolectin

Synonyms

MT75, 3110074E07Rik, PRED12

MMRRC Submission

Accession Numbers

Genbank: NM_139134 ; MGI: 2179069

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78930948-78951733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78946713 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 229 (L229F)

Ref Sequence

ENSEMBL: ENSMUSP00000063961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023568] [ENSMUST00000069148] [ENSMUST00000114216] [ENSMUST00000232415]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023568
AA Change: L229F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023568
Gene: ENSMUSG00000022860
AA Change: L229F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CLECT	31	179	4.07e-25	SMART
transmembrane domain	218	240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069148
AA Change: L229F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063961
Gene: ENSMUSG00000022860
AA Change: L229F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CLECT	31	179	4.07e-25	SMART
transmembrane domain	218	240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114216
AA Change: L229F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109854
Gene: ENSMUSG00000022860
AA Change: L229F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CLECT	31	179	4.07e-25	SMART
transmembrane domain	218	240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000232415
AA Change: L224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2125

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein with a carbohydrate recognition domain characteristic of C-type lectins in its extracellular portion. In other proteins, this domain is involved in endocytosis of glycoproteins and exogenous sugar-bearing pathogens. This protein localizes predominantly to the perinuclear region. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Chodl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Chodl	APN	16	78941263	missense	probably damaging	1.00
IGL01632:Chodl	APN	16	78944564	intron	probably benign
IGL01968:Chodl	APN	16	78941669	missense	probably damaging	1.00
IGL03095:Chodl	APN	16	78941433	missense	probably damaging	1.00
R0125:Chodl	UTSW	16	78941423	missense	probably damaging	1.00
R1852:Chodl	UTSW	16	78941258	missense	probably benign	0.01
R1938:Chodl	UTSW	16	78941426	missense	possibly damaging	0.77
R2109:Chodl	UTSW	16	78941363	missense	possibly damaging	0.58
R4362:Chodl	UTSW	16	78944658	critical splice donor site	probably null
R4502:Chodl	UTSW	16	78931444	missense	possibly damaging	0.65
R5299:Chodl	UTSW	16	78941408	missense	probably damaging	0.99
R5386:Chodl	UTSW	16	78946697	missense	probably damaging	1.00
R5677:Chodl	UTSW	16	78941315	missense	probably damaging	1.00
R6959:Chodl	UTSW	16	78946684	missense	probably damaging	1.00
R7138:Chodl	UTSW	16	78941447	missense	probably damaging	1.00
R7147:Chodl	UTSW	16	78946741	missense	probably damaging	1.00
R8067:Chodl	UTSW	16	78946713	missense	probably damaging	1.00
R8193:Chodl	UTSW	16	78941524	missense	probably damaging	1.00
R8924:Chodl	UTSW	16	78941771	missense	possibly damaging	0.70
X0067:Chodl	UTSW	16	78931373	missense	possibly damaging	0.46
YA93:Chodl	UTSW	16	78941282	missense	probably benign	0.11
Z1177:Chodl	UTSW	16	78941463	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GGGCTGTTTTCAAAGCATCC -3'
(R):5'- ATGCTGGAATTTTACTGACAGC -3'

Sequencing Primer
(F):5'- AACCTTGTATTGGGGTCC -3'
(R):5'- CCTTTAATTATCTGGACAGCAAT -3'

Posted On

2020-01-23