Incidental Mutation 'R8065:Fbxl16'
ID619971
Institutional Source Beutler Lab
Gene Symbol Fbxl16
Ensembl Gene ENSMUSG00000025738
Gene NameF-box and leucine-rich repeat protein 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8065 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25809085-25821244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25817983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 313 (V313I)
Ref Sequence ENSEMBL: ENSMUSP00000048562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045692]
Predicted Effect probably damaging
Transcript: ENSMUST00000045692
AA Change: V313I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738
AA Change: V313I

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL16, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Fbxl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Fbxl16 APN 17 25819364 splice site probably benign
BB002:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
BB012:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
R1848:Fbxl16 UTSW 17 25816446 missense probably benign
R5413:Fbxl16 UTSW 17 25816843 missense possibly damaging 0.92
R6018:Fbxl16 UTSW 17 25817735 missense probably damaging 1.00
R6048:Fbxl16 UTSW 17 25816993 missense probably benign 0.44
R6352:Fbxl16 UTSW 17 25818945 missense probably damaging 0.99
R7068:Fbxl16 UTSW 17 25819511 missense possibly damaging 0.86
R7089:Fbxl16 UTSW 17 25816729 missense probably benign 0.00
R7925:Fbxl16 UTSW 17 25816906 missense probably benign 0.00
R8067:Fbxl16 UTSW 17 25817983 missense probably damaging 0.99
X0025:Fbxl16 UTSW 17 25818515 missense probably damaging 1.00
Z1176:Fbxl16 UTSW 17 25817011 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGACTGCATCAATGTGGCAG -3'
(R):5'- TAGGGATGTGTGCACCTGTC -3'

Sequencing Primer
(F):5'- CTGCATCAATGTGGCAGATGATG -3'
(R):5'- TCCTCCAGTCGGTGCAAGTC -3'
Posted On2020-01-23