Incidental Mutation 'R8066:Adam29'
ID620007
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Namea disintegrin and metallopeptidase domain 29
Synonyms
Accession Numbers

Genbank: NM_175939; MGI: 2676326

Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8066 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location55870912-55906948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55872668 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 250 (L250F)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
Predicted Effect probably benign
Transcript: ENSMUST00000053441
AA Change: L250F

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: L250F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,971,929 Q421K possibly damaging Het
3632451O06Rik T C 14: 49,768,523 T572A possibly damaging Het
Acap1 A G 11: 69,889,863 V177A probably benign Het
Acsm2 C A 7: 119,591,325 T517K probably damaging Het
Ankrd37 T C 8: 45,997,689 D135G probably benign Het
Aspa T C 11: 73,313,546 K199E possibly damaging Het
Aurka A T 2: 172,370,418 I13K probably benign Het
Bag6 A G 17: 35,142,307 D446G unknown Het
Bcar3 A T 3: 122,524,924 I654F probably damaging Het
Ccdc188 A T 16: 18,219,194 N210Y probably damaging Het
Ccdc25 A T 14: 65,846,302 D28V possibly damaging Het
Cdc37 C T 9: 21,143,141 E63K probably benign Het
Chrm4 T A 2: 91,927,697 L150H probably damaging Het
Col5a2 A T 1: 45,413,468 probably null Het
Ctr9 T A 7: 111,033,897 Y117* probably null Het
Cyp4f37 C A 17: 32,635,073 R499S probably benign Het
Egr4 T C 6: 85,512,295 Y261C probably damaging Het
Fanca A T 8: 123,303,940 C468S unknown Het
Gart T C 16: 91,639,447 N141D probably benign Het
Get4 G A 5: 139,263,538 V126M probably damaging Het
Gja3 T C 14: 57,035,806 S370G probably benign Het
Gopc T C 10: 52,354,716 K162R probably benign Het
Grpel1 A G 5: 36,469,545 D57G probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kcnma1 A G 14: 23,311,676 L1149P probably benign Het
Lmbrd2 G A 15: 9,172,085 R322Q probably benign Het
Lrrc59 T C 11: 94,634,600 L74P possibly damaging Het
Mcam G T 9: 44,140,960 K589N probably damaging Het
Mgea5 T C 19: 45,771,852 K289R probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,354,130 L813Q possibly damaging Het
Olfr239 T C 17: 33,199,152 F35L probably benign Het
Olfr307 A T 7: 86,335,806 C197S probably benign Het
Olfr690 C T 7: 105,329,554 V213I possibly damaging Het
Pcdhga8 A T 18: 37,726,382 I164L probably benign Het
Pck2 C A 14: 55,544,401 P251H probably benign Het
Phip A T 9: 82,875,298 I1607K probably benign Het
Piwil2 T C 14: 70,420,719 T220A probably benign Het
Plch1 G A 3: 63,711,057 Q686* probably null Het
Pnpla2 A G 7: 141,459,668 *487W probably null Het
Prdm14 C A 1: 13,114,316 G544C probably benign Het
Psg22 A G 7: 18,718,293 E45G possibly damaging Het
Psmb5 T C 14: 54,614,241 D249G probably benign Het
Pstpip1 A G 9: 56,126,629 I296V probably benign Het
S1pr3 T A 13: 51,419,919 *379R probably null Het
Smc3 G A 19: 53,615,145 R57H probably damaging Het
Srcap C T 7: 127,521,632 R155C probably damaging Het
Srcap T A 7: 127,540,312 H1268Q possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Svep1 A G 4: 58,113,650 V999A probably benign Het
Tchp T A 5: 114,709,411 L97Q probably benign Het
Tex46 G A 4: 136,612,954 V117M probably benign Het
Tnnc2 T A 2: 164,777,741 I102F possibly damaging Het
Trbv5 T A 6: 41,062,392 C12S probably damaging Het
Trub2 T A 2: 29,777,855 T258S possibly damaging Het
Uba3 T A 6: 97,201,921 N87I probably damaging Het
Vmn1r160 A T 7: 22,871,890 I223F probably damaging Het
Vmn1r192 G T 13: 22,187,395 Y218* probably null Het
Vmn1r8 A G 6: 57,036,434 M157V probably benign Het
Vps53 T C 11: 76,136,307 E127G probably damaging Het
Vsig10 G T 5: 117,351,784 E538D probably benign Het
Wisp2 G T 2: 163,828,942 C123F probably damaging Het
Zfp647 A T 15: 76,911,895 H188Q probably damaging Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 55871844 missense probably benign 0.01
IGL01406:Adam29 APN 8 55871839 missense probably damaging 1.00
IGL01511:Adam29 APN 8 55871421 missense probably damaging 1.00
IGL01869:Adam29 APN 8 55871697 missense probably damaging 0.99
IGL01894:Adam29 APN 8 55871830 missense probably benign 0.00
IGL02023:Adam29 APN 8 55872484 missense probably benign 0.12
IGL02030:Adam29 APN 8 55872122 missense probably benign 0.35
IGL02071:Adam29 APN 8 55871554 missense possibly damaging 0.95
IGL02094:Adam29 APN 8 55871445 missense possibly damaging 0.48
IGL02108:Adam29 APN 8 55872311 missense probably damaging 0.98
IGL02125:Adam29 APN 8 55871939 nonsense probably null
IGL02330:Adam29 APN 8 55872363 missense probably benign 0.02
IGL02332:Adam29 APN 8 55871740 missense probably damaging 1.00
IGL02548:Adam29 APN 8 55872867 nonsense probably null
IGL02960:Adam29 APN 8 55872666 nonsense probably null
IGL03030:Adam29 APN 8 55873065 missense probably damaging 1.00
ANU22:Adam29 UTSW 8 55871844 missense probably benign 0.01
D4043:Adam29 UTSW 8 55872461 nonsense probably null
IGL02835:Adam29 UTSW 8 55873138 missense probably damaging 1.00
R0294:Adam29 UTSW 8 55873276 missense probably benign 0.25
R0449:Adam29 UTSW 8 55872681 missense probably benign 0.01
R0607:Adam29 UTSW 8 55873275 missense probably damaging 1.00
R0626:Adam29 UTSW 8 55871577 missense probably benign 0.24
R1296:Adam29 UTSW 8 55871719 nonsense probably null
R1752:Adam29 UTSW 8 55872274 missense probably damaging 0.98
R1930:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R1931:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R2397:Adam29 UTSW 8 55872898 missense probably benign 0.04
R2764:Adam29 UTSW 8 55871756 missense probably damaging 1.00
R4052:Adam29 UTSW 8 55872282 missense probably damaging 1.00
R4978:Adam29 UTSW 8 55871401 missense probably damaging 0.98
R5306:Adam29 UTSW 8 55871757 missense probably damaging 1.00
R6383:Adam29 UTSW 8 55871508 missense probably damaging 0.99
R6528:Adam29 UTSW 8 55872561 missense possibly damaging 0.93
R6579:Adam29 UTSW 8 55872744 missense probably damaging 1.00
R6707:Adam29 UTSW 8 55872100 missense probably damaging 1.00
R7076:Adam29 UTSW 8 55871659 missense probably damaging 1.00
R7099:Adam29 UTSW 8 55871404 missense probably benign 0.01
R7177:Adam29 UTSW 8 55872624 missense probably benign 0.30
R7320:Adam29 UTSW 8 55872714 missense possibly damaging 0.50
R7420:Adam29 UTSW 8 55872898 missense probably benign 0.04
R7438:Adam29 UTSW 8 55871574 missense probably damaging 0.99
R7476:Adam29 UTSW 8 55873195 missense probably damaging 0.97
R7524:Adam29 UTSW 8 55872360 missense probably damaging 1.00
R8111:Adam29 UTSW 8 55871550 missense probably benign 0.00
R8221:Adam29 UTSW 8 55872428 missense probably benign 0.02
R8350:Adam29 UTSW 8 55872189 missense possibly damaging 0.89
R8353:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
R8453:Adam29 UTSW 8 55873161 missense possibly damaging 0.82
R8723:Adam29 UTSW 8 55871478 missense probably damaging 1.00
R8752:Adam29 UTSW 8 55872293 nonsense probably null
R8809:Adam29 UTSW 8 55872624 missense probably benign 0.30
X0011:Adam29 UTSW 8 55873168 missense probably benign 0.02
Z1177:Adam29 UTSW 8 55871496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACAACTACGTTTTGGATC -3'
(R):5'- TGGTAATCCCATTCTCAAGCAAAG -3'

Sequencing Primer
(F):5'- CCCCAGTGGAACCTATGC -3'
(R):5'- AAGTAGTTTTGAAGACTGGTGGACCC -3'
Posted On2020-01-23