Incidental Mutation 'R8066:Pck2'
ID620024
Institutional Source Beutler Lab
Gene Symbol Pck2
Ensembl Gene ENSMUSG00000040618
Gene Namephosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms1810010O14Rik, 9130022B02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8066 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55540266-55551242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55544401 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 251 (P251H)
Ref Sequence ENSEMBL: ENSMUSP00000038555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048781] [ENSMUST00000226352] [ENSMUST00000226519] [ENSMUST00000228240]
Predicted Effect probably benign
Transcript: ENSMUST00000048781
AA Change: P251H

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038555
Gene: ENSMUSG00000040618
AA Change: P251H

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PEPCK 73 664 1.9e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226231
Predicted Effect probably benign
Transcript: ENSMUST00000226352
AA Change: P224H

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226519
AA Change: P224H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000228240
AA Change: P216H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000228921
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,971,929 Q421K possibly damaging Het
3632451O06Rik T C 14: 49,768,523 T572A possibly damaging Het
Acap1 A G 11: 69,889,863 V177A probably benign Het
Acsm2 C A 7: 119,591,325 T517K probably damaging Het
Adam29 T G 8: 55,872,668 L250F probably benign Het
Ankrd37 T C 8: 45,997,689 D135G probably benign Het
Aspa T C 11: 73,313,546 K199E possibly damaging Het
Aurka A T 2: 172,370,418 I13K probably benign Het
Bag6 A G 17: 35,142,307 D446G unknown Het
Bcar3 A T 3: 122,524,924 I654F probably damaging Het
Ccdc188 A T 16: 18,219,194 N210Y probably damaging Het
Ccdc25 A T 14: 65,846,302 D28V possibly damaging Het
Cdc37 C T 9: 21,143,141 E63K probably benign Het
Chrm4 T A 2: 91,927,697 L150H probably damaging Het
Col5a2 A T 1: 45,413,468 probably null Het
Ctr9 T A 7: 111,033,897 Y117* probably null Het
Cyp4f37 C A 17: 32,635,073 R499S probably benign Het
Egr4 T C 6: 85,512,295 Y261C probably damaging Het
Fanca A T 8: 123,303,940 C468S unknown Het
Gart T C 16: 91,639,447 N141D probably benign Het
Get4 G A 5: 139,263,538 V126M probably damaging Het
Gja3 T C 14: 57,035,806 S370G probably benign Het
Gopc T C 10: 52,354,716 K162R probably benign Het
Grpel1 A G 5: 36,469,545 D57G probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kcnma1 A G 14: 23,311,676 L1149P probably benign Het
Lmbrd2 G A 15: 9,172,085 R322Q probably benign Het
Lrrc59 T C 11: 94,634,600 L74P possibly damaging Het
Mcam G T 9: 44,140,960 K589N probably damaging Het
Mgea5 T C 19: 45,771,852 K289R probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,354,130 L813Q possibly damaging Het
Olfr239 T C 17: 33,199,152 F35L probably benign Het
Olfr307 A T 7: 86,335,806 C197S probably benign Het
Olfr690 C T 7: 105,329,554 V213I possibly damaging Het
Pcdhga8 A T 18: 37,726,382 I164L probably benign Het
Phip A T 9: 82,875,298 I1607K probably benign Het
Piwil2 T C 14: 70,420,719 T220A probably benign Het
Plch1 G A 3: 63,711,057 Q686* probably null Het
Pnpla2 A G 7: 141,459,668 *487W probably null Het
Prdm14 C A 1: 13,114,316 G544C probably benign Het
Psg22 A G 7: 18,718,293 E45G possibly damaging Het
Psmb5 T C 14: 54,614,241 D249G probably benign Het
Pstpip1 A G 9: 56,126,629 I296V probably benign Het
S1pr3 T A 13: 51,419,919 *379R probably null Het
Smc3 G A 19: 53,615,145 R57H probably damaging Het
Srcap C T 7: 127,521,632 R155C probably damaging Het
Srcap T A 7: 127,540,312 H1268Q possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Svep1 A G 4: 58,113,650 V999A probably benign Het
Tchp T A 5: 114,709,411 L97Q probably benign Het
Tex46 G A 4: 136,612,954 V117M probably benign Het
Tnnc2 T A 2: 164,777,741 I102F possibly damaging Het
Trbv5 T A 6: 41,062,392 C12S probably damaging Het
Trub2 T A 2: 29,777,855 T258S possibly damaging Het
Uba3 T A 6: 97,201,921 N87I probably damaging Het
Vmn1r160 A T 7: 22,871,890 I223F probably damaging Het
Vmn1r192 G T 13: 22,187,395 Y218* probably null Het
Vmn1r8 A G 6: 57,036,434 M157V probably benign Het
Vps53 T C 11: 76,136,307 E127G probably damaging Het
Vsig10 G T 5: 117,351,784 E538D probably benign Het
Wisp2 G T 2: 163,828,942 C123F probably damaging Het
Zfp647 A T 15: 76,911,895 H188Q probably damaging Het
Other mutations in Pck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pck2 APN 14 55542641 missense probably benign 0.30
IGL00430:Pck2 APN 14 55543944 missense probably benign 0.07
IGL00814:Pck2 APN 14 55548299 unclassified probably benign
IGL01012:Pck2 APN 14 55544069 splice site probably benign
IGL02095:Pck2 APN 14 55542510 missense probably benign 0.02
IGL02227:Pck2 APN 14 55543866 missense probably benign
IGL02435:Pck2 APN 14 55544390 splice site probably benign
IGL03124:Pck2 APN 14 55545333 missense probably damaging 1.00
R0271:Pck2 UTSW 14 55544584 critical splice donor site probably null
R1014:Pck2 UTSW 14 55542410 missense probably benign 0.00
R1116:Pck2 UTSW 14 55545366 missense probably benign 0.00
R1640:Pck2 UTSW 14 55548584 missense possibly damaging 0.51
R1793:Pck2 UTSW 14 55543965 missense possibly damaging 0.81
R1965:Pck2 UTSW 14 55542507 missense probably benign 0.07
R1983:Pck2 UTSW 14 55544068 splice site probably null
R3196:Pck2 UTSW 14 55543992 missense probably damaging 1.00
R4751:Pck2 UTSW 14 55542561 missense probably damaging 1.00
R5385:Pck2 UTSW 14 55545231 missense probably damaging 1.00
R5960:Pck2 UTSW 14 55548547 missense possibly damaging 0.48
R6134:Pck2 UTSW 14 55543962 missense probably damaging 1.00
R6276:Pck2 UTSW 14 55542624 missense probably damaging 1.00
R7030:Pck2 UTSW 14 55547766 missense probably damaging 1.00
R7199:Pck2 UTSW 14 55548712 missense probably benign 0.43
R7516:Pck2 UTSW 14 55542456 missense probably benign 0.00
X0065:Pck2 UTSW 14 55548063 missense probably benign 0.01
Z1176:Pck2 UTSW 14 55545269 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTCGACAGGTCTGACAAAG -3'
(R):5'- TACCACAGCTGCTCAGTTCC -3'

Sequencing Primer
(F):5'- TCTGACAAAGCACGAGGGCTG -3'
(R):5'- AGCTGCTCAGTTCCTCACCAG -3'
Posted On2020-01-23