Incidental Mutation 'R8066:Gja3'
ID620025
Institutional Source Beutler Lab
Gene Symbol Gja3
Ensembl Gene ENSMUSG00000048582
Gene Namegap junction protein, alpha 3
SynonymsCx46, Gja-3, connexin 46, alpha 3 connexin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8066 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57034460-57058100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57035806 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 370 (S370G)
Ref Sequence ENSEMBL: ENSMUSP00000059587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061614] [ENSMUST00000223792]
Predicted Effect probably benign
Transcript: ENSMUST00000061614
AA Change: S370G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000059587
Gene: ENSMUSG00000048582
AA Change: S370G

DomainStartEndE-ValueType
CNX 43 76 4.4e-21 SMART
low complexity region 103 116 N/A INTRINSIC
Connexin_CCC 165 231 3.36e-44 SMART
low complexity region 342 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223792
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutants exhibit lens nuclear cataracts associated with breakdown of gamma crystallin. Severity of the defect is influenced by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,971,929 Q421K possibly damaging Het
3632451O06Rik T C 14: 49,768,523 T572A possibly damaging Het
Acap1 A G 11: 69,889,863 V177A probably benign Het
Acsm2 C A 7: 119,591,325 T517K probably damaging Het
Adam29 T G 8: 55,872,668 L250F probably benign Het
Ankrd37 T C 8: 45,997,689 D135G probably benign Het
Aspa T C 11: 73,313,546 K199E possibly damaging Het
Aurka A T 2: 172,370,418 I13K probably benign Het
Bag6 A G 17: 35,142,307 D446G unknown Het
Bcar3 A T 3: 122,524,924 I654F probably damaging Het
Ccdc188 A T 16: 18,219,194 N210Y probably damaging Het
Ccdc25 A T 14: 65,846,302 D28V possibly damaging Het
Cdc37 C T 9: 21,143,141 E63K probably benign Het
Chrm4 T A 2: 91,927,697 L150H probably damaging Het
Col5a2 A T 1: 45,413,468 probably null Het
Ctr9 T A 7: 111,033,897 Y117* probably null Het
Cyp4f37 C A 17: 32,635,073 R499S probably benign Het
Egr4 T C 6: 85,512,295 Y261C probably damaging Het
Fanca A T 8: 123,303,940 C468S unknown Het
Gart T C 16: 91,639,447 N141D probably benign Het
Get4 G A 5: 139,263,538 V126M probably damaging Het
Gopc T C 10: 52,354,716 K162R probably benign Het
Grpel1 A G 5: 36,469,545 D57G probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kcnma1 A G 14: 23,311,676 L1149P probably benign Het
Lmbrd2 G A 15: 9,172,085 R322Q probably benign Het
Lrrc59 T C 11: 94,634,600 L74P possibly damaging Het
Mcam G T 9: 44,140,960 K589N probably damaging Het
Mgea5 T C 19: 45,771,852 K289R probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,354,130 L813Q possibly damaging Het
Olfr239 T C 17: 33,199,152 F35L probably benign Het
Olfr307 A T 7: 86,335,806 C197S probably benign Het
Olfr690 C T 7: 105,329,554 V213I possibly damaging Het
Pcdhga8 A T 18: 37,726,382 I164L probably benign Het
Pck2 C A 14: 55,544,401 P251H probably benign Het
Phip A T 9: 82,875,298 I1607K probably benign Het
Piwil2 T C 14: 70,420,719 T220A probably benign Het
Plch1 G A 3: 63,711,057 Q686* probably null Het
Pnpla2 A G 7: 141,459,668 *487W probably null Het
Prdm14 C A 1: 13,114,316 G544C probably benign Het
Psg22 A G 7: 18,718,293 E45G possibly damaging Het
Psmb5 T C 14: 54,614,241 D249G probably benign Het
Pstpip1 A G 9: 56,126,629 I296V probably benign Het
S1pr3 T A 13: 51,419,919 *379R probably null Het
Smc3 G A 19: 53,615,145 R57H probably damaging Het
Srcap C T 7: 127,521,632 R155C probably damaging Het
Srcap T A 7: 127,540,312 H1268Q possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Svep1 A G 4: 58,113,650 V999A probably benign Het
Tchp T A 5: 114,709,411 L97Q probably benign Het
Tex46 G A 4: 136,612,954 V117M probably benign Het
Tnnc2 T A 2: 164,777,741 I102F possibly damaging Het
Trbv5 T A 6: 41,062,392 C12S probably damaging Het
Trub2 T A 2: 29,777,855 T258S possibly damaging Het
Uba3 T A 6: 97,201,921 N87I probably damaging Het
Vmn1r160 A T 7: 22,871,890 I223F probably damaging Het
Vmn1r192 G T 13: 22,187,395 Y218* probably null Het
Vmn1r8 A G 6: 57,036,434 M157V probably benign Het
Vps53 T C 11: 76,136,307 E127G probably damaging Het
Vsig10 G T 5: 117,351,784 E538D probably benign Het
Wisp2 G T 2: 163,828,942 C123F probably damaging Het
Zfp647 A T 15: 76,911,895 H188Q probably damaging Het
Other mutations in Gja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Gja3 APN 14 57035679 missense probably damaging 1.00
R0470:Gja3 UTSW 14 57036427 missense probably damaging 1.00
R0631:Gja3 UTSW 14 57036762 missense possibly damaging 0.95
R1455:Gja3 UTSW 14 57036385 missense probably damaging 1.00
R1687:Gja3 UTSW 14 57036876 missense probably damaging 0.99
R2229:Gja3 UTSW 14 57036714 missense probably damaging 1.00
R3846:Gja3 UTSW 14 57035704 nonsense probably null
R5337:Gja3 UTSW 14 57035832 missense probably benign 0.22
R5797:Gja3 UTSW 14 57035713 missense probably damaging 0.98
R5940:Gja3 UTSW 14 57035860 missense probably damaging 0.99
R7226:Gja3 UTSW 14 57035893 missense probably benign 0.01
Z1088:Gja3 UTSW 14 57035815 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCTCAGTGTTTCCCTCAGG -3'
(R):5'- GACTCTAAACGATGCTCAAGGC -3'

Sequencing Primer
(F):5'- AATCCAGCACTGTCAGGTTTTTG -3'
(R):5'- GGCAGAAACCACCCAGTC -3'
Posted On2020-01-23