Incidental Mutation 'R8066:Gart'
ID620031
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8066 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91639447 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 141 (N141D)
Ref Sequence ENSEMBL: ENSMUSP00000023684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000231444] [ENSMUST00000232289] [ENSMUST00000232367]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: N141D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120450
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: N141D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962
AA Change: N141D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231380
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231444
Predicted Effect probably benign
Transcript: ENSMUST00000232289
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232367
AA Change: N141D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,971,929 Q421K possibly damaging Het
3632451O06Rik T C 14: 49,768,523 T572A possibly damaging Het
Acap1 A G 11: 69,889,863 V177A probably benign Het
Acsm2 C A 7: 119,591,325 T517K probably damaging Het
Adam29 T G 8: 55,872,668 L250F probably benign Het
Ankrd37 T C 8: 45,997,689 D135G probably benign Het
Aspa T C 11: 73,313,546 K199E possibly damaging Het
Aurka A T 2: 172,370,418 I13K probably benign Het
Bag6 A G 17: 35,142,307 D446G unknown Het
Bcar3 A T 3: 122,524,924 I654F probably damaging Het
Ccdc188 A T 16: 18,219,194 N210Y probably damaging Het
Ccdc25 A T 14: 65,846,302 D28V possibly damaging Het
Cdc37 C T 9: 21,143,141 E63K probably benign Het
Chrm4 T A 2: 91,927,697 L150H probably damaging Het
Col5a2 A T 1: 45,413,468 probably null Het
Ctr9 T A 7: 111,033,897 Y117* probably null Het
Cyp4f37 C A 17: 32,635,073 R499S probably benign Het
Egr4 T C 6: 85,512,295 Y261C probably damaging Het
Fanca A T 8: 123,303,940 C468S unknown Het
Get4 G A 5: 139,263,538 V126M probably damaging Het
Gja3 T C 14: 57,035,806 S370G probably benign Het
Gopc T C 10: 52,354,716 K162R probably benign Het
Grpel1 A G 5: 36,469,545 D57G probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kcnma1 A G 14: 23,311,676 L1149P probably benign Het
Lmbrd2 G A 15: 9,172,085 R322Q probably benign Het
Lrrc59 T C 11: 94,634,600 L74P possibly damaging Het
Mcam G T 9: 44,140,960 K589N probably damaging Het
Mgea5 T C 19: 45,771,852 K289R probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,354,130 L813Q possibly damaging Het
Olfr239 T C 17: 33,199,152 F35L probably benign Het
Olfr307 A T 7: 86,335,806 C197S probably benign Het
Olfr690 C T 7: 105,329,554 V213I possibly damaging Het
Pcdhga8 A T 18: 37,726,382 I164L probably benign Het
Pck2 C A 14: 55,544,401 P251H probably benign Het
Phip A T 9: 82,875,298 I1607K probably benign Het
Piwil2 T C 14: 70,420,719 T220A probably benign Het
Plch1 G A 3: 63,711,057 Q686* probably null Het
Pnpla2 A G 7: 141,459,668 *487W probably null Het
Prdm14 C A 1: 13,114,316 G544C probably benign Het
Psg22 A G 7: 18,718,293 E45G possibly damaging Het
Psmb5 T C 14: 54,614,241 D249G probably benign Het
Pstpip1 A G 9: 56,126,629 I296V probably benign Het
S1pr3 T A 13: 51,419,919 *379R probably null Het
Smc3 G A 19: 53,615,145 R57H probably damaging Het
Srcap C T 7: 127,521,632 R155C probably damaging Het
Srcap T A 7: 127,540,312 H1268Q possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Svep1 A G 4: 58,113,650 V999A probably benign Het
Tchp T A 5: 114,709,411 L97Q probably benign Het
Tex46 G A 4: 136,612,954 V117M probably benign Het
Tnnc2 T A 2: 164,777,741 I102F possibly damaging Het
Trbv5 T A 6: 41,062,392 C12S probably damaging Het
Trub2 T A 2: 29,777,855 T258S possibly damaging Het
Uba3 T A 6: 97,201,921 N87I probably damaging Het
Vmn1r160 A T 7: 22,871,890 I223F probably damaging Het
Vmn1r192 G T 13: 22,187,395 Y218* probably null Het
Vmn1r8 A G 6: 57,036,434 M157V probably benign Het
Vps53 T C 11: 76,136,307 E127G probably damaging Het
Vsig10 G T 5: 117,351,784 E538D probably benign Het
Wisp2 G T 2: 163,828,942 C123F probably damaging Het
Zfp647 A T 15: 76,911,895 H188Q probably damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGACACATTGAGGCCCAC -3'
(R):5'- AAGATTATCTGTTCTACAGGTCTGC -3'

Sequencing Primer
(F):5'- TTGAGGCCCACTCCAGAAG -3'
(R):5'- GTGACCTAACTATATGTGGAAAAAGC -3'
Posted On2020-01-23