Incidental Mutation 'R8067:Efhd1'
ID 620039
Institutional Source Beutler Lab
Gene Symbol Efhd1
Ensembl Gene ENSMUSG00000026255
Gene Name EF hand domain containing 1
Synonyms PP3051, mitocalcin, 4931430I01Rik
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 87192085-87238561 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87192313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 48 (P48S)
Ref Sequence ENSEMBL: ENSMUSP00000027472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027472] [ENSMUST00000118687]
AlphaFold Q9D4J1
Predicted Effect probably benign
Transcript: ENSMUST00000027472
AA Change: P48S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027472
Gene: ENSMUSG00000026255
AA Change: P48S

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
EFh 95 123 1.11e-3 SMART
EFh 131 159 2.64e-1 SMART
coiled coil region 203 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118687
AA Change: P48S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112980
Gene: ENSMUSG00000026255
AA Change: P48S

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
EFh 95 123 1.11e-3 SMART
EFh 131 159 2.64e-1 SMART
coiled coil region 203 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EF-hand super family of calcium binding proteins, which are involved in a variety of cellular processes including mitosis, synaptic transmission, and cytoskeletal rearrangement. The protein encoded by this gene is composed of an N-terminal disordered region, proline-rich elements, two EF-hands, and a C-terminal coiled-coil domain. This protein has been shown to associate with the mitochondrial inner membrane, and in HeLa cells, acts as a novel mitochondrial calcium ion sensor for mitochondrial flash activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Efhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Efhd1 APN 1 87,192,334 (GRCm39) missense probably damaging 1.00
IGL03062:Efhd1 APN 1 87,192,406 (GRCm39) missense possibly damaging 0.55
R1673:Efhd1 UTSW 1 87,192,404 (GRCm39) missense probably damaging 0.99
R2163:Efhd1 UTSW 1 87,217,195 (GRCm39) missense probably damaging 1.00
R2310:Efhd1 UTSW 1 87,192,350 (GRCm39) missense probably damaging 1.00
R2566:Efhd1 UTSW 1 87,237,477 (GRCm39) missense possibly damaging 0.72
R4996:Efhd1 UTSW 1 87,192,280 (GRCm39) missense possibly damaging 0.95
R5508:Efhd1 UTSW 1 87,237,516 (GRCm39) makesense probably null
R7090:Efhd1 UTSW 1 87,217,219 (GRCm39) missense probably damaging 0.96
R8065:Efhd1 UTSW 1 87,192,313 (GRCm39) missense probably benign 0.01
R8935:Efhd1 UTSW 1 87,217,219 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTCCACCGAGCGTCAGAAAG -3'
(R):5'- GCGCTCACGTTTTGAACATC -3'

Sequencing Primer
(F):5'- GAGCGCACAACTCTCTGTC -3'
(R):5'- GAACATCTTCTCCAGATCCTTCAGG -3'
Posted On 2020-01-23