Incidental Mutation 'R8067:Olfr1138'
ID620043
Institutional Source Beutler Lab
Gene Symbol Olfr1138
Ensembl Gene ENSMUSG00000075149
Gene Nameolfactory receptor 1138
SynonymsGA_x6K02T2Q125-49242149-49241214, MOR177-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8067 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87736747-87739978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87737803 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 174 (I174F)
Ref Sequence ENSEMBL: ENSMUSP00000148941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099848] [ENSMUST00000214573]
Predicted Effect probably damaging
Transcript: ENSMUST00000099848
AA Change: I174F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097435
Gene: ENSMUSG00000075149
AA Change: I174F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-45 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214573
AA Change: I174F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6630 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,558,643 D145E possibly damaging Het
Adcy7 T C 8: 88,311,069 L255P probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Cd209c A C 8: 3,945,700 M34R probably benign Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dopey1 A G 9: 86,518,339 Y1017C probably benign Het
Dopey2 T A 16: 93,765,448 L927* probably null Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fam208b C T 13: 3,569,602 V2210I probably benign Het
Fam83b T C 9: 76,491,098 T908A probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Git2 C T 5: 114,766,518 M113I probably damaging Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
H60c A C 10: 3,259,338 L217V unknown Het
Iba57 T C 11: 59,163,260 probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Prpf8 T C 11: 75,500,150 W1342R probably damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Spock1 A T 13: 57,696,171 probably null Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tmed2 T C 5: 124,546,923 I134T possibly damaging Het
Washc2 T A 6: 116,224,503 S353R probably damaging Het
Xdh T A 17: 73,900,657 R902W probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Olfr1138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Olfr1138 APN 2 87737986 missense probably benign 0.01
IGL02490:Olfr1138 APN 2 87737955 missense probably damaging 1.00
IGL02730:Olfr1138 APN 2 87737641 missense probably damaging 1.00
IGL03106:Olfr1138 APN 2 87738118 missense probably benign 0.02
IGL03113:Olfr1138 APN 2 87738162 missense probably benign 0.01
R0450:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0469:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0510:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R3696:Olfr1138 UTSW 2 87738016 missense probably benign
R3698:Olfr1138 UTSW 2 87738016 missense probably benign
R5149:Olfr1138 UTSW 2 87737405 missense probably benign
R5156:Olfr1138 UTSW 2 87737775 missense possibly damaging 0.95
R6245:Olfr1138 UTSW 2 87737896 missense possibly damaging 0.54
R6701:Olfr1138 UTSW 2 87737409 missense probably benign
R7170:Olfr1138 UTSW 2 87737712 missense probably damaging 0.99
R7185:Olfr1138 UTSW 2 87738145 missense probably damaging 1.00
R7260:Olfr1138 UTSW 2 87738508 splice site probably null
R8065:Olfr1138 UTSW 2 87737803 missense probably damaging 1.00
R8671:Olfr1138 UTSW 2 87737646 missense probably damaging 0.96
R8953:Olfr1138 UTSW 2 87738027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATTGCAACAGCAGTCAGG -3'
(R):5'- GGCAGTGATGGCATTTGATC -3'

Sequencing Primer
(F):5'- GGTAGAGAAAGCTTTTAACCTCCCAG -3'
(R):5'- GGCATTTGATCGATATAAGGCC -3'
Posted On2020-01-23